# Fileset

[Immunostimulatory Effects of Guani-2025-Pathak.pdf](https://mdr.nims.go.jp/filesets/53f00caf-a66c-4d23-9398-75de5a4ee6c6/download)

## Creator

[Soumitra Pathak](https://orcid.org/0000-0002-1007-4738), [Nguyen Bui Thao Le](https://orcid.org/0000-0002-4797-2339), [Taiji Oyama](https://orcid.org/0000-0003-1403-073X), Yusuke Odahara, Atsuya Momotake, [Kazunori Ikebukuro](https://orcid.org/0000-0003-2838-0562), [Chiho Kataoka-Hamai](https://orcid.org/0000-0002-4068-0405), [Chiaki Yoshikawa](https://orcid.org/0000-0002-6589-387X), [Kohsaku Kawakami](https://orcid.org/0000-0002-3466-9365), Yoshihisa Kaizuka, [Tomohiko Yamazaki](https://orcid.org/0000-0003-2136-8042)

## Rights

[Creative Commons BY Attribution 4.0 International](https://creativecommons.org/licenses/by/4.0/)

## Other metadata

[Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides](https://mdr.nims.go.jp/datasets/ea9b2ba4-40f2-45fb-a1ad-191c440735df)

## Fulltext

Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG OligodeoxynucleotidesAcademic Editor: Paolo FagoneReceived: 15 November 2024Revised: 30 December 2024Accepted: 4 January 2025Published: 10 January 2025Citation: Pathak, S.; Le, N.B.T.;Oyama, T.; Odahara, Y.; Momotake, A.;Ikebukuro, K.; Kataoka-Hamai, C.;Yoshikawa, C.; Kawakami, K.;Kaizuka, Y.; et al. ImmunostimulatoryEffects of Guanine-QuadruplexTopologies as Scaffolds for CpGOligodeoxynucleotides. Biomolecules2025, 15, 95. https://doi.org/10.3390/biom15010095Copyright: © 2025 by the authors.Licensee MDPI, Basel, Switzerland.This article is an open access articledistributed under the terms andconditions of the Creative CommonsAttribution (CC BY) license(https://creativecommons.org/licenses/by/4.0/).ArticleImmunostimulatory Effects of Guanine-Quadruplex Topologiesas Scaffolds for CpG OligodeoxynucleotidesSoumitra Pathak 1,2 , Nguyen Bui Thao Le 1,2 , Taiji Oyama 3,4 , Yusuke Odahara 5, Atsuya Momotake 5,Kazunori Ikebukuro 4 , Chiho Kataoka-Hamai 1, Chiaki Yoshikawa 1,2 , Kohsaku Kawakami 1 ,Yoshihisa Kaizuka 1 and Tomohiko Yamazaki 1,2,*1 Research Center for Macromolecules and Biomaterials, National Institute for Materials Science (NIMS),1-2-1 Sengen, Tsukuba 305-0047, Japan; pathak.soumitra@nims.go.jp (S.P.); jtef1940@tmd.ac.jp (N.B.T.L.);kataoka.chiho@nims.go.jp (C.K.-H.); yoshikawa.chiaki@nims.go.jp (C.Y.);kawakami.kohsaku@nims.go.jp (K.K.); kaizuka.yoshihisa@nims.go.jp (Y.K.)2 Graduate School of Life Science, Hokkaido University, Kita 10, Nishi 8, Sapporo 060-0808, Japan3 JASCO Corporation, Hachioji 192-8537, Japan; taiji.oyama@jasco.co.jp4 Department of Biotechnology and Life Science, Graduate School of Engineering, Tokyo University ofAgriculture and Technology, Koganei 184-8588, Japan; ikebu@cc.tuat.ac.jp5 Department of Chemistry, University of Tsukuba, Tsukuba 305-8571, Japan; s2220202@u.tsukuba.ac.jp (Y.O.);amomotak@chem.tsukuba.ac.jp (A.M.)* Correspondence: yamazaki.tomohiko@nims.go.jp; Tel.: +81-29-859-2345; Fax: +81-29-859-2449Abstract: Synthetic cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODNs) arepromising candidates for vaccine adjuvants, because they activate immune responsesthrough the Toll-like receptor 9 (TLR9) pathway. However, unmodified CpG ODNs arequickly degraded by serum nucleases, and their negative charge hinders cellular uptake,limiting their clinical application. Our group previously reported that guanine-quadruplex(G4)-forming CpG ODNs exhibit enhanced stability and cellular uptake. G4 structures canform in parallel, anti-parallel, or hybrid topologies, depending on strand orientation, butthe effects of these topologies on CpG ODNs have not yet been explored. In this study,we designed three distinct G4 topologies as scaffolds for CpG ODNs. Among the threetopology, the parallel G4 CpG ODN demonstrated the highest serum stability and cellularuptake, resulting in the strongest immune response from macrophage cells. Additionally,we investigated the binding affinities of the different G4 topologies to macrophage scav-enger receptor-1 and TLR9, both of which are key to immune activation. These findingsprovide valuable insights into the development of CpG ODN-based vaccine adjuvants.Keywords: CpG oligodeoxynucleotides; adjuvants; guanine-quadruplex; immune response;toll like receptor 9; macrophage cells; topology; serum stability; cellular uptake1. IntroductionInnate immunity is activated when the immune system encounters pathogenic par-ticles or pathogen-associated molecular patterns (PAMPs), which are present in manyinfectious microorganisms [1]. DNA motifs containing unmethylated cytosine-guaninedinucleotides (CpG) flanked by two purines at the 5′ end and two pyrimidines at the 3′ endare recognized by Toll-like receptor 9 (TLR9), leading to the production of interleukins (IL-6,IL-12, and IL-18), immunoglobulin M, interferon-γ, and tumor necrosis factor-α, therebyinitiating an innate immune response. These CpG-rich motifs are approximately 20 timesmore common in microbial DNA than in mammalian DNA due to differences in theirutilization frequency [2]. The scarcity of CpG motifs in mammalian DNA, coupled withBiomolecules 2025, 15, 95 https://doi.org/10.3390/biom15010095https://doi.org/10.3390/biom15010095https://doi.org/10.3390/biom15010095https://creativecommons.org/licenses/by/4.0/https://creativecommons.org/licenses/by/4.0/https://www.mdpi.com/journal/biomoleculeshttps://www.mdpi.comhttps://orcid.org/0000-0002-1007-4738https://orcid.org/0000-0002-4797-2339https://orcid.org/0000-0003-1403-073Xhttps://orcid.org/0000-0003-2838-0562https://orcid.org/0000-0002-6589-387Xhttps://orcid.org/0000-0002-3466-9365https://orcid.org/0000-0003-2136-8042https://doi.org/10.3390/biom15010095https://www.mdpi.com/article/10.3390/biom15010095?type=check_update&version=1Biomolecules 2025, 15, 95 2 of 16cytosine methylation that inactivates these motifs, reflects evolutionary divergence, makingCpG dinucleotide-containing DNA motifs potent PAMPs with strong immunostimula-tory potential [3]. In the absence of microbial pathogens, synthetic oligodeoxynucleotides(ODNs) containing CpG motifs can mimic this immunostimulatory effect, positioning themas promising candidates for vaccine adjuvants [4].However, the clinical application of CpG ODNs is limited by enzymatic degradationthrough serum nucleases, which target the phosphodiester (PD) bonds in these molecules.Various strategies have been employed to stabilize CpG ODNs for therapeutic use. Forinstance, substituting the PD bond’s double-bonded oxygen with sulfur to form a phos-phorothioate (PT) bond has been shown to increase stability against enzymatic degrada-tion [5]. Although this modification enhances stability, it also raises biosafety concerns.PT-modified CpG ODNs have been associated with prolonged local immune stimulation,which raises concerns about potential autoimmune responses [6,7], and cases of significantlymphadenopathy have been reported following administration [8].Guanine-quadruplexes (G4s) represent a non-canonical secondary structure of single-stranded nucleic acids rich in guanine sequences. G4s are categorized as either intramolec-ular or intermolecular structures, with intramolecular G4s showing particular promise inpharmaceutical applications due to their monomeric nature and controllable structural prop-erties [9]. Guanine residues within the G-tracts of a sequence form Hoogsteen hydrogenbonds with each other, creating G-quartets [10]. Multiple G-quartets can stack, and centrallylocated metal ions such as K+ and Na+ interact with the O6 position of guanine [11], gen-erating a strong negative electrostatic potential that stabilizes the G-quadruplex structureunder physiological conditions [12,13]. Our group previously leveraged the G4 structureas a scaffold for non-modified PD backbone-based CpG ODNs, achieving enhanced serumstability [14–16].G-quadruplexes can be classified into three topologies—parallel, anti-parallel, andhybrid—based on the glycosidic bond angles (anti or syn) of the guanine residues in theG-tracts [17]. In parallel topology, the four guanine strands align in the same direction; inanti-parallel, two strands are oriented in one direction and two in the opposite; in hybridtopology, one strand has a different direction than the other three [18]. Factors influencingG-quadruplex folding into a specific topology include the type of metal ion present betweenG-quartets. For instance, K+ ions in human telomeric sequences promote a hybrid topol-ogy, while Na+ favors anti-parallel [19] and Ca2+ encourages parallel topology [20]. Thelength of loops between G-tracts also influences G4 topology, with shorter loops typicallyfavoring a parallel structure [21,22]. Studies indicate that parallel G4s tend to adopt stableconformations, making them a preferred topology under physiological conditions [23,24].Our previous work involved designing G4 CpG ODNs in hybrid and anti-paralleltopologies to enhance their nuclease resistance and cellular uptake, which, in turn, aug-mented their immunostimulatory effects [14,25]. We further demonstrated that G4 CpGODNs initially in hybrid topology could transition to parallel topology upon binding withthe ligand L2G2-2M2EG-6OTD. This ligand-induced parallel topology increased nucle-ase resistance and cellular uptake but significantly reduced immunostimulatory activitycompared to the original hybrid G4 CpG ODN [16].Although G-quadruplexes show great potential as scaffolds for CpG ODNs, the impactof topological variation on immunological outcomes remains poorly understood. Thisstudy aims to elucidate the effect of G-quadruplex topology on immunostimulatory activity.We designed and characterized three G4 topologies—parallel, anti-parallel, and hybrid—incorporated with CpG ODNs. We then evaluated their topology in both extracellularand intracellular environments, as well as their nuclease resistance, cellular uptake, TLR9interaction, and immunostimulatory effects. Our results demonstrate that the parallelBiomolecules 2025, 15, 95 3 of 16topology is superior as a CpG ODN scaffold, with its high nuclease resistance and cellularuptake contributing significantly to enhanced immunostimulatory activity.2. Materials and Methods2.1. ODNsAll ODNs with PD backbones, listed in Table 1, were purchased from Eurofins Ge-nomics (Tokyo, Japan) and were of HPLC grade. To assess cellular uptake, Cy5-labeledODNs were used, with labeling at the 5′ end.Table 1. Sequence of oligonucleotides used in this study.Name Sequence (5′-3′) Length (bp)GD2_H GGGTTGGGGTCGTTTTGTCGTTGGGTTGGG 30GD2_AP GGGTTGGGAGTCGTTTTGTCGTTAGGGTTGGG 32GD2_P GGGTGGGAGTCGTTTTGTCGTTAGGGTGGG 30GD2_H-GpC GGGTTGGGGTGCTTTTGTGCTTGGGTTGGG 30GD2_AP-GpC GGGTTGGGAGTGCTTTTGTGCTTAGGGTTGGG 32GD2_P-GpC GGGTGGGAGTGCTTTTGTGCTTAGGGTGGG 30ss30mer GTCGTTTTGTCGTTTTGTCGTTTTGTCGTT 30ss32mer GTCGTTTTGTCGTTTTGTCGTTTTGTCGTTTT 32G-tracts are marked in bold, CpG/GpC motifs are underlined, and changes in GpC motifs are colored in red.2.2. G4 Structure FormationG4 structures were formed from randomly coiled ODNs following a previously pub-lished protocol from our group [25]. Briefly, all ODNs were diluted in Dulbecco’s phosphate-buffered saline (DPBS; Nacalai Tesque, Kyoto, Japan) containing 2.68 mM KCl, 137 mMNaCl, 1.47 mM KH2PO4, and 8.10 mM Na2HPO4. The ODN solutions were heated ina thermal cycler (PCR Thermal Cycler Dice Standard TP650, Takara Bio, Shiga, Japan)at 95 ◦C for 5 min to fully dissociate the structure and then cooled to 30 ◦C at a rate of1 ◦C/min to induce G4 formation. The folded ODN solutions were stored at 4 ◦C untilfurther use.2.3. Circular Dichroism SpectroscopyTo investigate the topology of G4 CpG ODNs, Circular dichroism (CD) spectra wereobtained in DPBS using a J-725 or J-1500 spectropolarimeter (JASCO, Tokyo, Japan) aspreviously described [15]. ODNs were prepared at a concentration of 2 µM in a 10 mmpath-length quartz cell. G4 CpG ODN topologies were also analyzed under simulated earlyendosomal and lysosomal conditions using vesicle-mimicking buffers: an early endosomalbuffer; a 60 mM potassium phosphate buffer containing 20 mM NaCl and 20% (w/v)PEG200 at pH 6.5, and a lysosomal buffer; and a 175 mM acetic acid buffer containing60 mM KCl, 20 mM NaCl, and 20% (w/v) PEG200 at pH 4.5. G4 CpG ODNs were incubatedin these buffers at 37 ◦C for 3 h before measuring their CD spectra. Melting curve analysiswas performed using the baseline method [26] in DPBS buffer, and melting temperatures(Tm) were calculated based on a previously reported method [25]. Principal componentanalysis (PCA) of the G4 CpG ODNs was conducted as outlined in our previous work [16].A library of 30 reference CD spectra of G4 structures was used to create the PCA score plot,and then 95% confidence ellipses were created using the PCA scores 1 and 2 of each groupof reference samples.Biomolecules 2025, 15, 95 4 of 162.4. Polyacrylamide Gel Electrophoresis (PAGE)PAGE was conducted with 1 mm thick, 4–20% pre-cast polyacrylamide gels (TEFCO,Tokyo, Japan) in Tris-borate-EDTA (TBE; 0.089 M Tris-Borate, 0.002 M EDTA, pH 8.3; TakaraBio, Shiga, Japan) buffer supplemented with 4 mM KCl at a constant voltage of 180 V forapproximately 80 min, as previously described [15]. The electrophoresis was performed at4 ◦C to prevent G4 CpG ODN conformational changes due to heat.2.5. Size Exclusion Chromatography (SEC-HPLC)SEC-HPLC analysis was performed using a Yarra SEC-2000 column (300 × 7.8 mm,3 µm, Phenomenex, Torrance, CA, USA) with DPBS as the mobile phase. A 5 µL volumeof 5 µM ODNs was injected, and the flow rate was set at 0.6 mL/min. Absorbance wasdetected at 260 nm to determine the elution time.2.6. Purity Analysis via NMRA 1H NMR spectrum was recorded using an AVANCE 600 spectrometer (BrukerInstruments, Inc., Bellerica, MA, USA). Folded G4 CpG ODNs at a concentration of 300 µMwere dissolved in MilliQ water containing 10% D2O, 50 mM KCl, and 10 mM potassiumphosphate buffer (pH 6.59). Spectra were acquired at a frequency of 600 MHz with aspectral width of 25 ppm, 8192 data points, a relaxation delay of 2 s, and 64 transients at25 ◦C. A total of 1024 scans were performed, with water suppression achieved using thewatergate method [27].2.7. Serum Stability AssayThe serum stability of G4 CpG ODNs was evaluated following a previously describedprotocol [28]. Briefly, ODNs were incubated in 50% (v/v) fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA) at 37 ◦C for 0, 1, 2, 4, and 24 h. The amount of undegradedODNs was quantified using PAGE.2.8. Cell CultureMouse macrophage-like RAW 264 cells (RIKEN BioResource Center, Ibaraki, Japan)were cultured as described in our previous studies [15]. RAW264.7 cells with knocked-out macrophage scavenger receptor-1 (Msr-1) genes (RAW MSR-1 KO) were generouslyprovided by Prof. Makiya Nishikawa of the Tokyo University of Science [29]. Cellswere maintained in RPMI 1640 medium (Thermo Fisher Scientific, Waltham, MA, USA)supplemented with 10% (v/v) heat-inactivated FBS, 100 U/mL penicillin, and 100 µg/mLstreptomycin. Cultures were incubated at 37 ◦C in a humidified atmosphere with 5% CO2.2.9. Quantification of Immunostimulatory ActivityTo achieve a cell density of 1 × 105 cells/well, 190 µL of cell suspension (5.3 × 105 cells/mL)was added to each well of a 96-well plate. After 18 h of incubation, 10 µL of ODN solutionwas added to the culture medium. Following 24 h of stimulation at 37 ◦C in a humidified5% CO2 incubator, the supernatant was collected. Interleukin-6 (IL-6) levels were measuredusing a mouse IL-6 ELISA kit (Ready-Set-Go kit, Thermo Fisher, Waltham, MA, USA)following the manufacturer’s instructions.2.10. Quantification of Cellular UptakeCells (4 × 105 cells/well) were seeded in a 48-well plate and incubated for 18 h. Themedium was then replaced with 200 µL of serum-free opti-MEM (Thermo Fisher Scientific)containing 0.5 µM Cy5-labeled G4 CpG ODNs. After 2 h, cells were harvested using a 0.5%(w/v) trypsin-0.2 mmol/L EDTA treatment, washed twice with phosphate-buffered saline(PBS), and collected by centrifugation at 500× g for 10 min. Cells were then resuspended inBiomolecules 2025, 15, 95 5 of 16500 µL PBS, and the mean fluorescence intensity (MFI) from Cy5 was quantified using aspectral cell analyzer (SP6800, Sony, Tokyo, Japan).2.11. Confocal MicroscopyThe localization of G4 CpG ODNs was examined via confocal microscopy (TCS SP5,Leica Microsystems, Wetzlar, Germany). Cells (2 × 105) were cultured on a 35 mm ibiTreatdish with a 4-well silicon micro-insert (ibidi, Gräfelfing, Germany) for 24 h to form acell layer. The medium was replaced with 10 µL of fresh medium containing 4 µM Cy5-labeled G4 CpG ODN. After 2 h, cells were washed twice with PBS. The MemBrite Fix CellSurface Staining Kit (Biotium, Fremont, CA, USA) was used for cell membrane staining.Cells were washed twice with ice-cold PBS and fixed with 4% paraformaldehyde at roomtemperature for 10 min. After further washing with PBS, 10 µL of SlowFade DiamondAntifade Mountant with DAPI (Thermo Fisher Scientific) was added to each well to stainthe nuclei. Cy5 signal quantification was performed on three randomly selected points inthe confocal images.2.12. Immunoprecipitation AssayTo quantify the binding of G4 CpG ODNs to TLR9, an immunoprecipitation assaywas performed using the Dynabeads Protein G Immunoprecipitation Kit (Thermo FisherScientific). A total of 50 µL of Dynabeads solution was mixed with 200 µL of recombinantmouse TLR9Fc (mTLR9Fc, 2 µg/mL in PBS, R&D Systems, Minneapolis, MN, USA) andincubated at 25 ◦C for 20 min. The mTLR9Fc-immobilized Dynabeads were then washedtwice with PBS to remove excess mTLR9Fc. G4 CpG ODNs were diluted to 10 µM in earlyendosomal buffer (pH 6.5) and added to the mTLR9Fc-immobilized Dynabeads, followedby a 30 min incubation, resulting in a final G4 CpG ODN concentration of 2 µM. TheDynabeads were washed with early endosomal buffer, and the G4 CpG ODNs bound toTLR9 were eluted using 10 µL of 50 mM glycine (pH 2.8). The G4 CpG ODN bound toTLR9 was analyzed by PAGE using 15% polyacrylamide gel in TBE buffer, and SDS-PAGEwas performed in TG-SDS buffer using a 15% polyacrylamide gel to confirm the presenceof mTLR9Fc.2.13. Statistical AnalysisOne-way analysis of variance (ANOVA) was used to assess statistical differences, fol-lowed by Tukey’s multiple comparisons test for comparisons between groups or Dunnett’smultiple comparisons test when comparing to a control group. Statistical analyses wereperformed using GraphPad Prism version 8.2.0 for Windows (GraphPad Software, Boston,MA, USA).3. Results3.1. Design and Characterization of G4 CpG ODNsWe designed three distinct G4 CpG ODNs with different topologies, each containingtwo ‘GTCGTT’ CpG motifs within the second loop. Previously, our group synthesizedGD2_H, a G-quadruplex with a hybrid topology that includes two CpG motifs in thesecond loop [25]. In this study, we developed G4 CpG ODNs with parallel and anti-paralleltopologies, using GD2_H as a template sequence. By modifying the nucleotide length inthe loops of GD2_H, we created the mutants GD2_AP and GD2_P (Table 1). For GD2_AP,an adenine base was added to each side of the central loop containing the CpG motif.According to previous reports [30], a shorter loop region promotes a parallel G-quadruplextopology, so we designed GD2_P by deleting one thymine from the first and third loops ofGD2_AP. To confirm molecularity, native PAGE was performed in the presence of 4 mMBiomolecules 2025, 15, 95 6 of 16potassium ions in the running buffer. GD2_H (30-mer), GD2_AP (32-mer), and GD2_P (30-mer) displayed higher migration in polyacrylamide gel compared to single-stranded ODNsof similar length and linear structure (Figure 1A), suggesting compact three-dimensionalstructures. GD2_P showed the highest mobility among the three samples, while GD2_Hand GD2_AP displayed distinct single bands. For GD2_P, an additional faint band aroundthe 37 bp region was observed alongside the primary band. Further analysis using SEC-HPLC revealed a single peak for each sample, with elution times longer than those oflinear samples, confirming compact structures (Figure 1B–D). The primary peak area forGD2_P was about 90%, indicating that the majority of GD2_P was present as a monomericparallel topology.Biomolecules 2025, 15, x FOR PEER REVIEW 6 of 17  the second loop [25]. In this study, we developed G4 CpG ODNs with parallel and anti-parallel topologies, using GD2_H as a template sequence. By modifying the nucleotide length in the loops of GD2_H, we created the mutants GD2_AP and GD2_P (Table 1). For GD2_AP, an adenine base was added to each side of the central loop containing the CpG motif. According to previous reports [30], a shorter loop region promotes a parallel G-quadruplex topology, so we designed GD2_P by deleting one thymine from the first and third loops of GD2_AP. To confirm molecularity, native PAGE was performed in the presence of 4 mM potassium ions in the running buffer. GD2_H (30-mer), GD2_AP (32-mer), and GD2_P (30-mer) displayed higher migration in polyacrylamide gel com-pared to single-stranded ODNs of similar length and linear structure (Figure 1A), sug-gesting compact three-dimensional structures. GD2_P showed the highest mobility among the three samples, while GD2_H and GD2_AP displayed distinct single bands. For GD2_P, an additional faint band around the 37 bp region was observed alongside the primary band. Further analysis using SEC-HPLC revealed a single peak for each sample, with elution times longer than those of linear samples, confirming compact structures (Figure 1B–D). The primary peak area for GD2_P was about 90%, indicating that the majority of GD2_P was present as a monomeric parallel topology.  Figure 1. Molecularity analysis of G4 CpG ODNs. (A) Polyacrylamide gel electrophoresis analysis of G4 CpG ODNs was performed in a 4–20% gradient polyacrylamide gel in tris-borate EDTA buffer with 4mM KCl as supplement. (B–D) Size exclusion HPLC chromatograms of G4 CpG ODNs. Additionally, the formation of G-quadruplex DNA, GD2_P, was confirmed through characterization using 1H NMR. In the downfield-shifted portion of the NMR spectrum of GD2_P (Supplementary Figure S1), imino proton signals were observed at the chemi-cal shifts of ≳10 ppm, a range characteristic of guanine imino protons involved in hydro-gen bond formation with their carbonyl oxygen atoms (i.e., NH−OC hydrogen bonds) [31]. The observation of the sharp imino proton signals is consistent with the formation of a G-quadruplex structure stabilized by three stacked G-quartets, indicating that the G-quadruplex adopts a relatively homogeneous conformation. Figure 1. Molecularity analysis of G4 CpG ODNs. (A) Polyacrylamide gel electrophoresis analysis ofG4 CpG ODNs was performed in a 4–20% gradient polyacrylamide gel in tris-borate EDTA bufferwith 4mM KCl as supplement. (B–D) Size exclusion HPLC chromatograms of G4 CpG ODNs.Additionally, the formation of G-quadruplex DNA, GD2_P, was confirmed throughcharacterization using 1H NMR. In the downfield-shifted portion of the NMR spectrum ofGD2_P (Supplementary Figure S1), imino proton signals were observed at the chemicalshifts of ≳10 ppm, a range characteristic of guanine imino protons involved in hydrogenbond formation with their carbonyl oxygen atoms (i.e., NH−OC hydrogen bonds) [31].The observation of the sharp imino proton signals is consistent with the formation ofa G-quadruplex structure stabilized by three stacked G-quartets, indicating that the G-quadruplex adopts a relatively homogeneous conformation.To confirm the G-quadruplex topology, we measured the CD spectrum in DPBS, whichsimulates physiological ion concentrations of the cell culture medium. At 37 ◦C in DPBS,GD2_H exhibited a CD spectrum with a negative peak around 240 nm, a broad positivepeak around 260 nm, and another positive maximum around 290 nm (Figure 2A), char-acteristic of a hybrid G4 topology [32]. GD2_AP displayed a negative minimum around260 nm and a positive maximum around 290 nm, indicating an anti-parallel topology [33].Conversely, GD2_P showed a parallel topology with a negative minimum at 240 nm and apositive maximum at 260 nm [33]. All of the G4 CpG ODNs were found to maintain theirrespective topologies also at a room temperature of 25 ◦C (Supplementary Figure S8). CDBiomolecules 2025, 15, 95 7 of 16spectra were also obtained under conditions mimicking the intracellular environment. Al-though the three G4 CpG ODNs displayed different topologies in DPBS, all three exhibitedspectra with a positive maximum of around 260 nm and a negative minimum of around240 nm in early endosomal and lysosomal conditions (Figure 2B,C). A visual and subjectivejudgment is employed to determine the topology of G4 based solely on the shape of the CDspectrum. The topology of G4 nucleic acids can be evaluated objectively and quantitativelyby using PCA based on CD spectra of G4 structures with known 30 structures [16,34].GD2_H, GD2_AP, and GD_P were not within the ellipse because of the long randominsertion in the second loop of G4, affecting the whole CD spectrum. PCA score plotsconfirmed that GD2_H, GD2_AP, and GD2_P formed hybrid, anti-parallel, and parallelstructures, respectively, in DPBS (Figure 2D). Moreover, PCA indicated that all three G4CpG ODNs adopted parallel topologies under conditions simulating early endosomes andlysosomes. These findings demonstrated that all three types of G4 CpG ODNs maintainedtheir topology in the medium. After cell uptake, the topologies of GD2_H and GD2_APchanged into the parallel type within the endosome.Biomolecules 2025, 15, x FOR PEER REVIEW 7 of 17  To confirm the G-quadruplex topology, we measured the CD spectrum in DPBS, which simulates physiological ion concentrations of the cell culture medium. At 37 °C in DPBS, GD2_H exhibited a CD spectrum with a negative peak around 240 nm, a broad positive peak around 260 nm, and another positive maximum around 290 nm (Figure 2A), characteristic of a hybrid G4 topology [32]. GD2_AP displayed a negative minimum around 260 nm and a positive maximum around 290 nm, indicating an anti-parallel to-pology [33]. Conversely, GD2_P showed a parallel topology with a negative minimum at 240 nm and a positive maximum at 260 nm [33]. All of the G4 CpG ODNs were found to maintain their respective topologies also at a room temperature of 25 °C (Supplementary Figure S8). CD spectra were also obtained under conditions mimicking the intracellular environment. Although the three G4 CpG ODNs displayed different topologies in DPBS, all three exhibited spectra with a positive maximum of around 260 nm and a negative minimum of around 240 nm in early endosomal and lysosomal conditions (Figure 2B,C). A visual and subjective judgment is employed to determine the topology of G4 based solely on the shape of the CD spectrum. The topology of G4 nucleic acids can be evalu-ated objectively and quantitatively by using PCA based on CD spectra of G4 structures with known 30 structures [16,34]. GD2_H, GD2_AP, and GD_P were not within the el-lipse because of the long random insertion in the second loop of G4, affecting the whole CD spectrum. PCA score plots confirmed that GD2_H, GD2_AP, and GD2_P formed hybrid, anti-parallel, and parallel structures, respectively, in DPBS (Figure 2D). Moreo-ver, PCA indicated that all three G4 CpG ODNs adopted parallel topologies under con-ditions simulating early endosomes and lysosomes. These findings demonstrated that all three types of G4 CpG ODNs maintained their topology in the medium. After cell up-take, the topologies of GD2_H and GD2_AP changed into the parallel type within the endosome.  Biomolecules 2025, 15, x FOR PEER REVIEW 8 of 17   Figure 2. Circular dichroism (CD) spectrum of G4 CpG ODNs (A) in DPBS at 37 °C, (B) in early endosome mimicking buffer, and (C) in lysosome mimicking buffer at 37 °C. (D) Principal compo-nent analysis (PCA) score plots of G4 CpG ODNs. A library of 30 reference CD spectra of G4 struc-tures was used to create the PCA score plot (shown as triangles). PCA score plot of GD2_H, GD2_AP, and GD_P in DPBS, early endosome, and lysosome mimicking buffer marked with blue circles, green squares, and red stars, respectively. The ellipses indicate 95% confidence limits of re-spective topologies. Schematic diagram of the G4 CpG ODNs, (E) GD2_H, (F) GD2_AP, and (G) GD2_P. Base pairs present on the red line are in the loop region, and G-tracts are depicted in green. 3.2. Effect of G4 Topology on the Immunostimulatory Activity of CpG ODNs The immunostimulatory effects of G4 CpG ODNs were assessed by measuring IL-6 production in mouse macrophage-like RAW264 cells using ELISA. Following 24 h of in-cubation with the ODNs, cells treated with GD2_P produced IL-6 at levels four times higher than those treated with GD2_H and twice as high as those treated with GD2_AP, as shown in Figure 3. To confirm that IL-6 induction was due to the CpG motif in the second loop and not the G4 structure itself, we replaced the CG dinucleotide sequence with GC in all three G4 CpG ODNs, which formed GD2_H-GpC, GD2_AP-GpC, and GD2_P-GpC (Table 1). As a result, no IL-6 induction was observed in RAW264 cells treated with the modified G4 CpG ODNs with inverted CG sequences (Supplementary Figure S2). CD spectra were analyzed to confirm whether the G4 GpC ODNs maintain their respective topologies even after the inversion of CG dinucleotide. GD2_H, GD2_AP, and GD2_P were shown to retain their hybrid, anti-parallel, and parallel topologies, re-spectively (Supplementary Figure S7).  Figure 3. Cytokine induced by 4 µM of G4 CpG ODNs in mouse macrophage RAW264 cells after 24 h incubation. DPBS was used as control. Data are presented as means ± SD (n = 5). In the graph, **** p < 0.0001 and * p < 0.05 (one-way ANOVA, Tukey’s multiple comparisons test for comparison with other groups). Figure 2. Circular dichroism (CD) spectrum of G4 CpG ODNs (A) in DPBS at 37 ◦C, (B) in earlyendosome mimicking buffer, and (C) in lysosome mimicking buffer at 37 ◦C. (D) Principal componentanalysis (PCA) score plots of G4 CpG ODNs. A library of 30 reference CD spectra of G4 structureswas used to create the PCA score plot (shown as triangles). PCA score plot of GD2_H, GD2_AP,and GD_P in DPBS, early endosome, and lysosome mimicking buffer marked with blue circles,green squares, and red stars, respectively. The ellipses indicate 95% confidence limits of respectivetopologies. Schematic diagram of the G4 CpG ODNs, (E) GD2_H, (F) GD2_AP, and (G) GD2_P. Basepairs present on the red line are in the loop region, and G-tracts are depicted in green.Biomolecules 2025, 15, 95 8 of 163.2. Effect of G4 Topology on the Immunostimulatory Activity of CpG ODNsThe immunostimulatory effects of G4 CpG ODNs were assessed by measuring IL-6 production in mouse macrophage-like RAW264 cells using ELISA. Following 24 h ofincubation with the ODNs, cells treated with GD2_P produced IL-6 at levels four timeshigher than those treated with GD2_H and twice as high as those treated with GD2_AP, asshown in Figure 3. To confirm that IL-6 induction was due to the CpG motif in the secondloop and not the G4 structure itself, we replaced the CG dinucleotide sequence with GCin all three G4 CpG ODNs, which formed GD2_H-GpC, GD2_AP-GpC, and GD2_P-GpC(Table 1). As a result, no IL-6 induction was observed in RAW264 cells treated with themodified G4 CpG ODNs with inverted CG sequences (Supplementary Figure S2). CDspectra were analyzed to confirm whether the G4 GpC ODNs maintain their respectivetopologies even after the inversion of CG dinucleotide. GD2_H, GD2_AP, and GD2_Pwere shown to retain their hybrid, anti-parallel, and parallel topologies, respectively(Supplementary Figure S7).Biomolecules 2025, 15, x FOR PEER REVIEW 8 of 17   Figure 2. Circular dichroism (CD) spectrum of G4 CpG ODNs (A) in DPBS at 37 °C, (B) in early endosome mimicking buffer, and (C) in lysosome mimicking buffer at 37 °C. (D) Principal compo-nent analysis (PCA) score plots of G4 CpG ODNs. A library of 30 reference CD spectra of G4 struc-tures was used to create the PCA score plot (shown as triangles). PCA score plot of GD2_H, GD2_AP, and GD_P in DPBS, early endosome, and lysosome mimicking buffer marked with blue circles, green squares, and red stars, respectively. The ellipses indicate 95% confidence limits of re-spective topologies. Schematic diagram of the G4 CpG ODNs, (E) GD2_H, (F) GD2_AP, and (G) GD2_P. Base pairs present on the red line are in the loop region, and G-tracts are depicted in green. 3.2. Effect of G4 Topology on the Immunostimulatory Activity of CpG ODNs The immunostimulatory effects of G4 CpG ODNs were assessed by measuring IL-6 production in mouse macrophage-like RAW264 cells using ELISA. Following 24 h of in-cubation with the ODNs, cells treated with GD2_P produced IL-6 at levels four times higher than those treated with GD2_H and twice as high as those treated with GD2_AP, as shown in Figure 3. To confirm that IL-6 induction was due to the CpG motif in the second loop and not the G4 structure itself, we replaced the CG dinucleotide sequence with GC in all three G4 CpG ODNs, which formed GD2_H-GpC, GD2_AP-GpC, and GD2_P-GpC (Table 1). As a result, no IL-6 induction was observed in RAW264 cells treated with the modified G4 CpG ODNs with inverted CG sequences (Supplementary Figure S2). CD spectra were analyzed to confirm whether the G4 GpC ODNs maintain their respective topologies even after the inversion of CG dinucleotide. GD2_H, GD2_AP, and GD2_P were shown to retain their hybrid, anti-parallel, and parallel topologies, re-spectively (Supplementary Figure S7).  Figure 3. Cytokine induced by 4 µM of G4 CpG ODNs in mouse macrophage RAW264 cells after 24 h incubation. DPBS was used as control. Data are presented as means ± SD (n = 5). In the graph, **** p < 0.0001 and * p < 0.05 (one-way ANOVA, Tukey’s multiple comparisons test for comparison with other groups). Figure 3. Cytokine induced by 4 µM of G4 CpG ODNs in mouse macrophage RAW264 cells after24 h incubation. DPBS was used as control. Data are presented as means ± SD (n = 5). In the graph,**** p < 0.0001 and * p < 0.05 (one-way ANOVA, Tukey’s multiple comparisons test for comparisonwith other groups).3.3. Effect of G4 Topology on Thermal Stability and Nuclease ResistanceThe structural stability of G4 CpG ODNs with different topologies was evaluatedthrough thermodynamic analysis using CD melting analysis. The temperature was in-creased at a rate of 1 ◦C/min over a range of 10 ◦C to 90 ◦C (Supplementary Figure S3). TheTm of GD2_H, GD2_AP, and GD2_P were determined to be 46.6 ◦C, 45.2 ◦C, and 48.6 ◦C, re-spectively. These results indicate that the parallel structure GD2_P exhibits greater stabilitythan the other topologies.We then investigated the nuclease resistance of the three G4 CpG ODN topologies inFBS, which contains nucleases known to degrade unmodified CpG ODNs. As illustratedin Figure 4, linear ODNs degraded rapidly in DPBS containing 50% FBS, with no residualband visible after just an hour. In contrast, residual bands for the three G4 topologies wereobserved after 1, 2, and 4 h of incubation with FBS. Notably, after 24 h, the band for theparallel G4 (GD2_P) remained visible, whereas the bands for the hybrid and anti-parallelG4 structures were no longer detectable. Quantification of the ODN bands confirmedthat the parallel G4 CpG ODN (GD2_P) displayed the highest stability among the threetopologies (Figure 4D).Biomolecules 2025, 15, 95 9 of 16Biomolecules 2025, 15, x FOR PEER REVIEW 9 of 17  3.3. Effect of G4 Topology on Thermal Stability and Nuclease Resistance The structural stability of G4 CpG ODNs with different topologies was evaluated through thermodynamic analysis using CD melting analysis. The temperature was in-creased at a rate of 1 °C/min over a range of 10 °C to 90 °C (Supplementary Figure S3). The Tm of GD2_H, GD2_AP, and GD2_P were determined to be 46.6 °C, 45.2 °C, and 48.6 °C, respectively. These results indicate that the parallel structure GD2_P exhibits greater stability than the other topologies. We then investigated the nuclease resistance of the three G4 CpG ODN topologies in FBS, which contains nucleases known to degrade unmodified CpG ODNs. As illus-trated in Figure 4, linear ODNs degraded rapidly in DPBS containing 50% FBS, with no residual band visible after just an hour. In contrast, residual bands for the three G4 to-pologies were observed after 1, 2, and 4 hours of incubation with FBS. Notably, after 24 h, the band for the parallel G4 (GD2_P) remained visible, whereas the bands for the hy-brid and anti-parallel G4 structures were no longer detectable. Quantification of the ODN bands confirmed that the parallel G4 CpG ODN (GD2_P) displayed the highest stability among the three topologies (Figure 4D).  Figure 4. Serum stability of three types of G4 CpG ODNs. After incubating G4 CpG ODNs with 50% FBS, samples were run in PAGE to visualize residual ODNs. (A) Hybrid GD2 with ss30mer of same length, (B) anti-parallel GD2_AP and ss32mer of same length, and (C) parallel GD2_P and ss30mer of same length. Bands of DNA ladders are in bp. (D) Correlation between serum treat-ment time and residual ODN level. 3.4. Effect of G4 Topology on Cellular Uptake of CpG ODNs CpG ODNs activate the immune system by binding to TLR9 in endosomes [35]. For G4 CpG ODNs to induce an immune response in cells, they must first be internalized. We examined the cellular uptake of Cy5-labeled G4 CpG ODNs using flow cytometry. Histograms of fluorescence levels in the cells treated with the different G4 CpG ODN topologies are presented in Supplementary Figure S4. Figure 5 displays the flow cytome-try analysis of the RAW264 cells after 2 hours of incubation with Cy5-labeled G4 CpG ODNs. Among the three G-quadruplex topologies, the parallel-type GD2_P exhibited comparatively higher cellular uptake, followed by GD2_AP and GD2_H. We also com-Figure 4. Serum stability of three types of G4 CpG ODNs. After incubating G4 CpG ODNs with 50%FBS, samples were run in PAGE to visualize residual ODNs. (A) Hybrid GD2 with ss30mer of samelength, (B) anti-parallel GD2_AP and ss32mer of same length, and (C) parallel GD2_P and ss30mer ofsame length. Bands of DNA ladders are in bp. (D) Correlation between serum treatment time andresidual ODN level.3.4. Effect of G4 Topology on Cellular Uptake of CpG ODNsCpG ODNs activate the immune system by binding to TLR9 in endosomes [35]. ForG4 CpG ODNs to induce an immune response in cells, they must first be internalized. Weexamined the cellular uptake of Cy5-labeled G4 CpG ODNs using flow cytometry. His-tograms of fluorescence levels in the cells treated with the different G4 CpG ODN topologiesare presented in Supplementary Figure S4. Figure 5 displays the flow cytometry analysisof the RAW264 cells after 2 h of incubation with Cy5-labeled G4 CpG ODNs. Among thethree G-quadruplex topologies, the parallel-type GD2_P exhibited comparatively highercellular uptake, followed by GD2_AP and GD2_H. We also compared the uptake rate overtime for each topology (Supplementary Figure S5). Cellular uptake was detectable after10 min, with the parallel GD2_P showing the highest uptake rate among all topologies.Biomolecules 2025, 15, x FOR PEER REVIEW 10 of 17  pared the uptake rate over time for each topology (Supplementary Figure S5). Cellular uptake was detectable after 10 min, with the parallel GD2_P showing the highest uptake rate among all topologies.  Figure 5. Cellular uptake of G4 CpG ODNs in RAW264 cells. Cells were incubated with Cy5-labeled G4 CpG ODNs for 2 h before quantification. Data are presented as means ± SD (n = 3). In the graph, * p < 0.05, and ns (not significantly different) means p > 0.05 (one-way ANOVA, Tukey’s multiple comparisons test for comparison with other groups). Some ODNs bind non-specifically to cell membranes, remaining localized on the membrane [36]. To confirm internalization, we observed the localization of Cy5-labeled G4 CpG ODNs using confocal microscopy. As shown in Figure 6, all Cy5-labeled G4 CpG ODNs (visualized in red) displayed internalization within RAW264 cells. The Cy5-labeled G4 CpG ODNs localized in the cytoplasm in a punctate pattern, confirming their presence in intracellular vesicles. Quantification of the Cy5 signal revealed that the par-allel GD2_P had the highest internalization level among the three topologies (Supple-mentary Figure S6). Figure 5. Cellular uptake of G4 CpG ODNs in RAW264 cells. Cells were incubated with Cy5-labeledG4 CpG ODNs for 2 h before quantification. Data are presented as means ± SD (n = 3). In the graph,* p < 0.05, and ns (not significantly different) means p > 0.05 (one-way ANOVA, Tukey’s multiplecomparisons test for comparison with other groups).Biomolecules 2025, 15, 95 10 of 16Some ODNs bind non-specifically to cell membranes, remaining localized on themembrane [36]. To confirm internalization, we observed the localization of Cy5-labeledG4 CpG ODNs using confocal microscopy. As shown in Figure 6, all Cy5-labeled G4 CpGODNs (visualized in red) displayed internalization within RAW264 cells. The Cy5-labeledG4 CpG ODNs localized in the cytoplasm in a punctate pattern, confirming their presence inintracellular vesicles. Quantification of the Cy5 signal revealed that the parallel GD2_P hadthe highest internalization level among the three topologies (Supplementary Figure S6).Biomolecules 2025, 15, x FOR PEER REVIEW 11 of 17   Figure 6. Localization of Cy5 labeled G4 CpG ODNs in RAW264 cells. The cells were incubated with 0.5 µM of ODNs for 2 h and then observed under confocal microscopy. No treatment RAW264 cells were used as a control. The CpG ODNs are marked with Cy5 (red). The cell mem-branes and nuclei are stained with MemBrite (green) and DAPI (blue), respectively. 3.5. Investigation of the Uptake Receptor for G4 CpG ODNs We also explored the cellular uptake pathways for the different G4 CpG ODN to-pologies. Cell membranes contain various receptors and proteins that facilitate the up-take of DNA nanostructures [37,38]. Among these, the macrophage scavenger receptor-1 (MSR-1) receptor, encoded by the MSR-1 gene, has been identified as a key facilitator for the uptake of phosphodiester DNA in macrophage cells [29,39,40]. We investigated whether small DNA structures like G-quadruplexes are also internalized by immune cells through MSR-1, particularly when CpG motifs are incorporated. As shown in Figure 7A, all three G4 CpG ODN topologies demonstrated reduced uptake in RAW MSR-1 knockout (KO) cells compared with RAW264 cells. The parallel-type GD2_P displayed a twofold reduction in internalization in RAW MSR-1 KO cells. We further assessed whether this reduced uptake affected cytokine secretion. MSR-1 KO cells showed no cytokine secretion in response to any of the three G4 CpG ODN topolo-gies, in contrast to RAW264 cells (Figure 7B). These results indicate that the MSR-1 re-ceptor is involved in the uptake of G4 CpG ODNs and plays a crucial role in immune ac-tivation in RAW cells. Figure 6. Localization of Cy5 labeled G4 CpG ODNs in RAW264 cells. The cells were incubated with0.5 µM of ODNs for 2 h and then observed under confocal microscopy. No treatment RAW264 cellswere used as a control. The CpG ODNs are marked with Cy5 (red). The cell membranes and nucleiare stained with MemBrite (green) and DAPI (blue), respectively.3.5. Investigation of the Uptake Receptor for G4 CpG ODNsWe also explored the cellular uptake pathways for the different G4 CpG ODN topolo-gies. Cell membranes contain various receptors and proteins that facilitate the uptake ofDNA nanostructures [37,38]. Among these, the macrophage scavenger receptor-1 (MSR-1)receptor, encoded by the MSR-1 gene, has been identified as a key facilitator for the uptakeof phosphodiester DNA in macrophage cells [29,39,40]. We investigated whether smallDNA structures like G-quadruplexes are also internalized by immune cells through MSR-1,particularly when CpG motifs are incorporated.As shown in Figure 7A, all three G4 CpG ODN topologies demonstrated reduceduptake in RAW MSR-1 knockout (KO) cells compared with RAW264 cells. The parallel-typeBiomolecules 2025, 15, 95 11 of 16GD2_P displayed a twofold reduction in internalization in RAW MSR-1 KO cells. Wefurther assessed whether this reduced uptake affected cytokine secretion. MSR-1 KO cellsshowed no cytokine secretion in response to any of the three G4 CpG ODN topologies,in contrast to RAW264 cells (Figure 7B). These results indicate that the MSR-1 receptor isinvolved in the uptake of G4 CpG ODNs and plays a crucial role in immune activation inRAW cells.Biomolecules 2025, 15, x FOR PEER REVIEW 12 of 17   Figure 7. Studying receptor involved in cellular uptake of G4 CpG ODNs in RAW MSR-1 KO cells. (A) Cellular uptake of Cy5-labeled ODNs and (B) IL-6 secretion quantified by ELISA upon stimu-lation with G4 CpG ODNs. RAW264 cells were used as control. LPS was used as positive control for cell stimulation in ELISA. 3.6. TLR9 Affinity of G4 CpG ODNs and Immune Response Following cellular uptake, CpG ODNs are directed to endosomes [41]. To examine the binding affinity between TLR9 and the CpG motifs located in the loop region (Figure 2E–G) of G4 CpG ODNs, an immunoprecipitation assay was conducted under endo-some-mimicking conditions at pH 6.5 (Figure 8). Results showed that all three G4 CpG ODN topologies bound to TLR9. Quantitative analysis of fluorescence intensity in the ODN bands revealed similar levels of TLR9 binding affinity among the tested G4 CpG ODNs.  Figure 8. Binding between G4 CpG ODNs and mTLR9 using immunoprecipitation assay at pH 6.5. ‘−’ and ‘+’ sign signify absence of presence of mTLR9 Fc chimera in the sample, respectively. (A) Polyacrylamide gel (10–20%) visualized after staining with SBYR gold and running in TG buffer to observe DNA bands. (B) mTLR9 Fc chimera bound to protein G was visualized after running the sample in 15% polyacrylamide gel in TG-SDS buffer and stained in CBB stain. (C) Quantification of ODN bands visualized in PAGE.   Figure 7. Studying receptor involved in cellular uptake of G4 CpG ODNs in RAW MSR-1 KOcells. (A) Cellular uptake of Cy5-labeled ODNs and (B) IL-6 secretion quantified by ELISA uponstimulation with G4 CpG ODNs. RAW264 cells were used as control. LPS was used as positivecontrol for cell stimulation in ELISA.3.6. TLR9 Affinity of G4 CpG ODNs and Immune ResponseFollowing cellular uptake, CpG ODNs are directed to endosomes [41]. To exam-ine the binding affinity between TLR9 and the CpG motifs located in the loop region(Figure 2E–G) of G4 CpG ODNs, an immunoprecipitation assay was conducted underendosome-mimicking conditions at pH 6.5 (Figure 8). Results showed that all three G4 CpGODN topologies bound to TLR9. Quantitative analysis of fluorescence intensity in the ODNbands revealed similar levels of TLR9 binding affinity among the tested G4 CpG ODNs.Biomolecules 2025, 15, x FOR PEER REVIEW 12 of 17   Figure 7. Studying receptor involved in cellular uptake of G4 CpG ODNs in RAW MSR-1 KO cells. (A) Cellular uptake of Cy5-labeled ODNs and (B) IL-6 secretion quantified by ELISA upon stimu-lation with G4 CpG ODNs. RAW264 cells were used as control. LPS was used as positive control for cell stimulation in ELISA. 3.6. TLR9 Affinity of G4 CpG ODNs and Immune Response Following cellular uptake, CpG ODNs are directed to endosomes [41]. To examine the binding affinity between TLR9 and the CpG motifs located in the loop region (Figure 2E–G) of G4 CpG ODNs, an immunoprecipitation assay was conducted under endo-some-mimicking conditions at pH 6.5 (Figure 8). Results showed that all three G4 CpG ODN topologies bound to TLR9. Quantitative analysis of fluorescence intensity in the ODN bands revealed similar levels of TLR9 binding affinity among the tested G4 CpG ODNs.  Figure 8. Binding between G4 CpG ODNs and mTLR9 using immunoprecipitation assay at pH 6.5. ‘−’ and ‘+’ sign signify absence of presence of mTLR9 Fc chimera in the sample, respectively. (A) Polyacrylamide gel (10–20%) visualized after staining with SBYR gold and running in TG buffer to observe DNA bands. (B) mTLR9 Fc chimera bound to protein G was visualized after running the sample in 15% polyacrylamide gel in TG-SDS buffer and stained in CBB stain. (C) Quantification of ODN bands visualized in PAGE.   Figure 8. Binding between G4 CpG ODNs and mTLR9 using immunoprecipitation assay at pH6.5. ‘−’ and ‘+’ sign signify absence of presence of mTLR9 Fc chimera in the sample, respectively.(A) Polyacrylamide gel (10–20%) visualized after staining with SBYR gold and running in TG bufferto observe DNA bands. (B) mTLR9 Fc chimera bound to protein G was visualized after running thesample in 15% polyacrylamide gel in TG-SDS buffer and stained in CBB stain. (C) Quantification ofODN bands visualized in PAGE.Biomolecules 2025, 15, 95 12 of 164. DiscussionThe immune response mediated by CpG ODNs through recognition by the TLR9 recep-tor in immune cells presents a promising strategy for vaccine adjuvant development [42].However, natural linear CpG ODNs suffer from low nuclease resistance, limiting theireffectiveness. Although phosphorothioate-modified CpG ODNs offer increased stability,they raise safety concerns. To address this, our group previously developed G4 CpG ODNsas an alternative, avoiding safety risks while still activating immune responses in immunecells [14,15,25,43]. G4 CpG ODNs have shown higher immunostimulatory effects comparedto linear CpG ODNs, primarily due to their enhanced stability in the presence of serumnucleases, making them a viable option for vaccine adjuvant applications.G-quadruplexes can adopt three distinct topologies—parallel, anti-parallel, andhybrid—based on loop orientation [30]. However, the specific impact of these topolo-gies on the immunostimulatory activity of G4 CpG ODNs remains unclear. This studyaimed to design CpG ODNs with G-quadruplex scaffolds in these three topologies and toinvestigate how topology influences immunostimulatory effects. Our findings indicate thatparallel G4 CpG ODNs exhibit superior nuclease resistance and cellular uptake comparedto other topologies, which likely explains their enhanced immunostimulatory effects inmacrophage cells.Among all tested topologies, parallel G4 CpG ODNs triggered the strongest immunos-timulatory response, as evidenced by the highest IL-6 secretion in RAW264 cells (Figure 3).To understand this enhanced response, we examined the stability of the ODNs in cellularmedia with 50% serum, reflecting physiological serum concentrations. Previous studies,such as that by Luu et al. [19], have shown that human telomeric sequences in Na+ solu-tions form anti-parallel G4 structures, while in K+ solutions, they adopt a more compactparallel topology. This compact structure likely contributes to the parallel G4 CpG ODN’ssuperior resistance to nuclease degradation, remaining stable even after 24 h of incubation(Figure 4D). This observation aligns with our previous work, which demonstrated thatligand-induced parallel G4 CpG ODNs retain high stability in serum [16]. After cellularuptake, inside the endosome, all of the G4 CpG ODNs of different topologies fold them-selves into parallel topology due to the collective effect of molecular crowding and higherK+ concentration [44,45].Cy5-labeled parallel G4 CpG ODNs exhibited the highest cellular uptake in RAWcells (Figure 5). The compact structure of the parallel G4 CpG ODN likely facilitatesgreater cellular uptake due to its smaller molecular profile [46]. Previous research hasshown that G4 structures generally display enhanced uptake in cancer cells than non-G4sequences, with membrane proteins involved in this uptake [47,48]. The higher serumstability of parallel G4 CpG ODNs likely contributes to their availability in cellular mediafor internalization. Additionally, the strong binding affinity to receptors such as MSR-1may further enhance uptake into macrophage cells.In the present study, experiments with MSR-1 knockout RAW cells showed reduceduptake of G4 CpG ODNs and diminished IL-6 secretion, with the most substantial reductionobserved in the parallel topology (Figure 7). While various membrane proteins, includingMAC-1, AGER, MSR-1, MNAB, DEC205, and MRC1, are involved in DNA uptake, onlyMAC-1 and MSR-1 are found in immune cells [39,49–51]. Given the role of MSR-1 as amacrophage and dendritic cell surface receptor [52,53], all G4 CpG ODN topologies possiblyutilize MSR-1 for uptake and are subsequently directed to endosomes via clathrin-mediatedendocytosis (CME) [54]. The reduced uptake and cytokine induction in MSR-1 knockoutcells (Figure 7A,B) suggest that additional receptors may aid G4 CpG ODN uptake. Previousstudies reported that the mannose receptor can target CpG oligonucleotides and internalizethem in macrophage cells [51]. TRPC3/C6/C7 has also been reportedly involved in theBiomolecules 2025, 15, 95 13 of 16uptake of antisense oligonucleotides [55]. Thus, other receptors apart from MSR-1 arepossibly involved in RAW264 cells for internalizing G4 CpG ODNs. However, withoutMSR-1, internalized G4 CpG ODNs may not efficiently sort into endosomes, preventingTLR9 engagement and resulting in negligible IL-6 secretion (Figure 7B).In summary, this study provides insights into the immunostimulatory mechanisms ofG4 CpG ODNs. These molecules bind to MSR-1 receptors on macrophage cell surfaces, withparallel G4 CpG ODNs showing the highest affinity for receptor binding and subsequentinternalization. Upon cellular entry, G4 CpG ODNs are trafficked to endosomes via theCME pathway, where all topologies converge into the parallel form, enabling TLR9 bindingwithout topological preference. TLR9 engagement initiates downstream signaling, leadingto IL-6 secretion [56]. Given its increased serum stability and cellular internalization, theparallel G4 CpG ODN stimulates a more robust IL-6 response than other G4 topologies.5. ConclusionsWe synthesized G4 CpG ODNs with three distinct topologies and examined theirpathway from entry into cellular media to immune response activation, focusing on theirinteractions with different G4 CpG ODN topologies. Parallel G4 CpG ODNs demonstratedthe highest serum stability, strongest binding affinity to MSR-1, and greatest cellular uptake,resulting in the most robust immune response in macrophage cells. These findings offervaluable insights for designing G-quadruplex-based CpG ODNs as vaccine adjuvants withimproved stability and enhanced usability.Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom15010095/s1, Figure S1. 1H NMR spectra of GD2_P; Figure S2.A comparison of cytokine induction between G4 CpG ODNs and G4 GpC ODNs after incubatingthem in mouse macrophage RAW cells for 24 h; Figure S3. Melting curve analysis of G4 CpG ODNsby heating the G4 CpG ODNs from 10 ◦C to 90 ◦C in DPBS buffer; Figure S4. Histogram analysisof fluorescence intensity from RAW264 cells treated with Cy5 labeled G4 CpG ODNs; Figure S5.Comparison of rate of cellular uptake of Cy5 labeled G4 CpG ODNs by RAW cells after incubatingfor 2 h; Figure S6. Internalization of Cy5 labeled G4 CpG ODNs in RAW cells; Figure S7. Circulardichroism (CD) spectrum of G4 GpC ODNs in DPBS at 25 ◦C. Figure S8. Circular dichroism (CD)spectrum of G4 CpG ODNs in DPBS at 25 ◦C.Author Contributions: Conceptualization, T.Y.; data curation, S.P., K.I. and T.Y.; formal analysis, S.P.and T.Y.; funding acquisition, T.Y.; investigation, S.P., T.O., Y.O. and T.Y.; methodology, S.P., T.O.,Y.O., A.M., C.K.-H., Y.K. and T.Y.; project administration, T.Y.; resources, C.K.-H. and T.Y.; software,T.O.; supervision, N.B.T.L., A.M., K.I., C.K.-H., C.Y., K.K., Y.K. and T.Y.; validation, S.P. and T.Y.;visualization, S.P. and T.Y.; writing—original draft, S.P. and T.Y.; writing—review and editing, S.P.,T.O., A.M. and T.Y. All authors have read and agreed to the published version of the manuscript.Funding: This research was funded by the Japan Society for the Promotion of Science KAKENHI,grant number 21K19057 and also by the TIA collaborative research program “Kakehashi”, grantnumbers TK21-017 and TK22-033.Institutional Review Board Statement: Not applicable.Informed Consent Statement: Not applicable.Data Availability Statement: The original contributions presented in this study are included in thearticle/Supplementary Material. Further inquiries can be directed to the corresponding author.Acknowledgments: We are grateful to Miwako Shobo, Shinya Hattori, Xianglan Li, and TomoyoUmezawa for their kind assistance during the experiments. The authors would like to thank MakiyaNishikawa of the Tokyo University of Science for providing RAW264.7 cells with knocked-out Msr-1genes (RAW MSR-1 KO) used in this study. This work was conducted at the NIMS Molecule andhttps://www.mdpi.com/article/10.3390/biom15010095/s1https://www.mdpi.com/article/10.3390/biom15010095/s1Biomolecules 2025, 15, 95 14 of 16Material Synthesis Platform, supported by the Nanotechnology Platform Program of the Ministry ofEducation, Culture, Sports, Science, and Technology (MEXT), Japan, with the payment of user fees.Conflicts of Interest: Author Taiji Oyama was employed by the company JASCO. The remainingauthors declare that the research was conducted in the absence of any commercial or financialrelationships that could be construed as a potential conflict of interest.References1. Mogensen, T.H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 2009, 22,240–273. [CrossRef] [PubMed]2. Klinman, D.M.; Yi, A.-K.; Beaucage, S.L.; Conover, J.; Krieg, A.M. CpG motifs present in bacteria DNA rapidly induce lymphocytesto secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl. Acad. Sci. USA 1996, 93, 2879–2883. [CrossRef][PubMed]3. Häcker, G.; Redecke, V.; Häcker, H. Activation of the immune system by bacterial CpG-DNA. Immunology 2002, 105, 245–251.[CrossRef] [PubMed]4. Klinman, D.M. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat. Rev. Immunol. 2004, 4, 249–259. [CrossRef][PubMed]5. Krieg, A.M. Toll-like receptor 9 (TLR9) agonists in the treatment of cancer. Oncogene 2008, 27, 161–167. [CrossRef] [PubMed]6. Segal, B.M.; Chang, J.T.; Shevach, E.M. CpG oligonucleotides are potent adjuvants for the activation of autoreactive encephalito-genic T cells in vivo. J. Immunol. 2000, 164, 5683–5688. [CrossRef] [PubMed]7. Tsunoda, I.; Tolley, N.D.; Theil, D.J.; Whitton, J.L.; Kobayashi, H.; Fujinami, R.S. Exacerbation of viral and autoimmune animalmodels for multiple sclerosis by bacterial DNA. Brain Pathol. 1999, 9, 481–493. [CrossRef] [PubMed]8. Lipford, G.B.; Sparwasser, T.; Zimmermann, S.; Heeg, K.; Wagner, H. CpG-DNA-mediated transient lymphadenopathy isassociated with a state of Th1 predisposition to antigen-driven responses. J. Immunol. 2000, 165, 1228–1235. [CrossRef]9. Onel, B.; Lin, C.; Yang, D. DNA G-quadruplex and its potential as anticancer drug target. Sci. China Chem. 2014, 57, 1605–1614.[CrossRef] [PubMed]10. Spiegel, J.; Adhikari, S.; Balasubramanian, S. The structure and function of DNA G-quadruplexes. Trends Chem. 2020, 2, 123–136.[CrossRef] [PubMed]11. Sen, D.; Gilbert, W. A sodium-potassium switch in the formation of four-stranded G4-DNA. Nature 1990, 344, 410–414. [CrossRef]12. Sen, D.; Gilbert, W. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis.Nature 1988, 334, 364–366. [CrossRef] [PubMed]13. Sundquist, W.I.; Klug, A. Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature 1989, 342,825–829. [CrossRef] [PubMed]14. Safitri, F.A.; Tu, A.T.T.; Hoshi, K.; Shobo, M.; Zhao, D.; Witarto, A.B.; Sumarsono, S.H.; Giri-Rachman, E.A.; Tsukakoshi, K.;Ikebukuro, K. Enhancement of the immunostimulatory effect of phosphodiester CpG oligodeoxynucleotides by an antiparallelguanine-quadruplex structural scaffold. Biomolecules 2021, 11, 1617. [CrossRef] [PubMed]15. Hoshi, K.; Yamazaki, T.; Sugiyama, Y.; Tsukakoshi, K.; Tsugawa, W.; Sode, K.; Ikebukuro, K. G-quadruplex structure improves theimmunostimulatory effects of CpG oligonucleotides. Nucleic Acid Ther. 2019, 29, 224–229. [CrossRef]16. Tu, A.T.T.; Hoshi, K.; Ma, Y.; Oyama, T.; Suzuki, S.; Tsukakoshi, K.; Nagasawa, K.; Ikebukuro, K.; Yamazaki, T. Effects ofG-quadruplex ligands on the topology, stability, and immunostimulatory properties of G-quadruplex-based CpG oligodeoxynu-cleotides. ACS Chem. Biol. 2022, 17, 1703–1713. [CrossRef] [PubMed]17. Yuan, W.F.; Wan, L.Y.; Peng, H.; Zhong, Y.M.; Cai, W.L.; Zhang, Y.Q.; Ai, W.B.; Wu, J.F. The influencing factors and functions ofDNA G-quadruplexes. Cell Biochem. Funct. 2020, 38, 524–532. [CrossRef] [PubMed]18. Ma, Y.; Iida, K.; Nagasawa, K. Topologies of G-quadruplex: Biological functions and regulation by ligands. Biochem. Biophys. Res.Commun. 2020, 531, 3–17. [CrossRef] [PubMed]19. Luu, K.N.; Phan, A.T.; Kuryavyi, V.; Lacroix, L.; Patel, D.J. Structure of the human telomere in K+ solution: An intramolecular(3+1) G-quadruplex scaffold. J. Am. Chem. Soc. 2006, 128, 9963–9970. [CrossRef]20. Miyoshi, D.; Nakao, A.; Sugimoto, N. Structural transition from antiparallel to parallel G-quadruplex of d(G4T4G4) induced byCa2+. Nucleic Acids Res. 2003, 31, 1156–1163. [CrossRef] [PubMed]21. Phan, A.T.; Modi, Y.S.; Patel, D.J. Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter. J. Am. Chem.Soc. 2004, 126, 8710–8716. [CrossRef] [PubMed]22. Hazel, P.; Huppert, J.; Balasubramanian, S.; Neidle, S. Loop-length-dependent folding of G-quadruplexes. J. Am. Chem. Soc. 2004,126, 16405–16415. [CrossRef]23. Devi, G.; Winnerdy, F.R.; Ang, J.C.Y.; Lim, K.W.; Phan, A.T. Four-layered intramolecular parallel G-quadruplex with non-nucleotide loops: An ultra-stable self-folded DNA nano-scaffold. ACS Nano 2021, 16, 533–540. [CrossRef] [PubMed]https://doi.org/10.1128/CMR.00046-08https://www.ncbi.nlm.nih.gov/pubmed/19366914https://doi.org/10.1073/pnas.93.7.2879https://www.ncbi.nlm.nih.gov/pubmed/8610135https://doi.org/10.1046/j.0019-2805.2001.01350.xhttps://www.ncbi.nlm.nih.gov/pubmed/11918685https://doi.org/10.1038/nri1329https://www.ncbi.nlm.nih.gov/pubmed/15057783https://doi.org/10.1038/sj.onc.1210911https://www.ncbi.nlm.nih.gov/pubmed/18176597https://doi.org/10.4049/jimmunol.164.11.5683https://www.ncbi.nlm.nih.gov/pubmed/10820244https://doi.org/10.1111/j.1750-3639.1999.tb00537.xhttps://www.ncbi.nlm.nih.gov/pubmed/10416988https://doi.org/10.4049/jimmunol.165.3.1228https://doi.org/10.1007/s11426-014-5235-3https://www.ncbi.nlm.nih.gov/pubmed/27182219https://doi.org/10.1016/j.trechm.2019.07.002https://www.ncbi.nlm.nih.gov/pubmed/32923997https://doi.org/10.1038/344410a0https://doi.org/10.1038/334364a0https://www.ncbi.nlm.nih.gov/pubmed/3393228https://doi.org/10.1038/342825a0https://www.ncbi.nlm.nih.gov/pubmed/2601741https://doi.org/10.3390/biom11111617https://www.ncbi.nlm.nih.gov/pubmed/34827615https://doi.org/10.1089/nat.2018.0761https://doi.org/10.1021/acschembio.1c00904https://www.ncbi.nlm.nih.gov/pubmed/35765965https://doi.org/10.1002/cbf.3505https://www.ncbi.nlm.nih.gov/pubmed/32056246https://doi.org/10.1016/j.bbrc.2019.12.103https://www.ncbi.nlm.nih.gov/pubmed/31948752https://doi.org/10.1021/ja062791whttps://doi.org/10.1093/nar/gkg211https://www.ncbi.nlm.nih.gov/pubmed/12582234https://doi.org/10.1021/ja048805khttps://www.ncbi.nlm.nih.gov/pubmed/15250723https://doi.org/10.1021/ja045154jhttps://doi.org/10.1021/acsnano.1c07630https://www.ncbi.nlm.nih.gov/pubmed/34927423Biomolecules 2025, 15, 95 15 of 1624. Smargiasso, N.; Rosu, F.; Hsia, W.; Colson, P.; Baker, E.S.; Bowers, M.T.; De Pauw, E.; Gabelica, V. G-quadruplex DNA assemblies:Loop length, cation identity, and multimer formation. J. Am. Chem. Soc. 2008, 130, 10208–10216. [CrossRef] [PubMed]25. Tu, A.T.T.; Hoshi, K.; Ikebukuro, K.; Hanagata, N.; Yamazaki, T. Monomeric G-quadruplex-based CpG oligodeoxynucleotides aspotent toll-like receptor 9 agonists. Biomacromolecules 2020, 21, 3644–3657. [CrossRef]26. Mergny, J.L.; Lacroix, L. UV melting of G-quadruplexes. Curr. Protoc. Nucleic Acid Chem. 2009, 37, 17.1.1–17.1.15. [CrossRef]27. Piotto, M.; Saudek, V.; Sklenář, V. Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions.J. Biomol. NMR 1992, 2, 661–665. [CrossRef]28. Le, N.B.T.; Tu, A.T.T.; Zhao, D.; Yoshikawa, C.; Kawakami, K.; Kaizuka, Y.; Yamazaki, T. Influence of the Charge Ratio ofGuanine-Quadruplex Structure-Based CpG Oligodeoxynucleotides and Cationic DOTAP Liposomes on Cytokine InductionProfiles. Biomolecules 2023, 13, 1639. [CrossRef] [PubMed]29. Umemura, K.; Ohtsuki, S.; Nagaoka, M.; Kusamori, K.; Inoue, T.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Critical contributionof macrophage scavenger receptor 1 to the uptake of nanostructured DNA by immune cells. Nanomedicine: Nanotechnology.Biol. Med. 2021, 34, 102386.30. Cheng, M.; Cheng, Y.; Hao, J.; Jia, G.; Zhou, J.; Mergny, J.-L.; Li, C. Loop permutation affects the topology and stability ofG-quadruplexes. Nucleic Acids Res. 2018, 46, 9264–9275. [CrossRef] [PubMed]31. Yamamoto, Y.; Araki, H.; Shinomiya, R.; Hayasaka, K.; Nakayama, Y.; Ochi, K.; Shibata, T.; Momotake, A.; Ohyama, T.; Hagihara,M. Structures and catalytic activities of complexes between heme and all parallel-stranded monomeric G-quadruplex DNAs.Biochemistry 2018, 57, 5938–5948. [CrossRef] [PubMed]32. del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. Back Cover: G-Quadruplex Secondary Structure Obtained from Circular DichroismSpectroscopy (Angew. Chem. Int. Ed. 24/2018). Angew. Chem. Int. Ed. 2018, 57, 7256. [CrossRef]33. Zhou, B.; Geng, Y.; Liu, C.; Miao, H.; Ren, Y.; Xu, N.; Shi, X.; You, Y.; Lee, T.; Zhu, G. Characterizations of distinct parallel andantiparallel G-quadruplexes formed by two-repeat ALS and FTD related GGGGCC sequence. Sci. Rep. 2018, 8, 2366. [CrossRef][PubMed]34. del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. G-quadruplex secondary structure obtained from circular dichroism spectroscopy.Angew. Chem. 2018, 130, 7289–7293. [CrossRef]35. Iliev, D.B.; Skjæveland, I.; Jørgensen, J.B. CpG oligonucleotides bind TLR9 and RRM-Containing proteins in Atlantic Salmon(Salmo salar). BMC Immunol. 2013, 14, 12. [CrossRef] [PubMed]36. Nagaoka, M.; Liao, W.; Kusamori, K.; Nishikawa, M. Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides toAntigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization. Int. J. Mol. Sci. 2022,23, 1350. [CrossRef]37. Yakubov, L.A.; Deeva, E.A.; Zarytova, V.F.; Ivanova, E.M.; Ryte, A.S.; Yurchenko, L.V.; Vlassov, V.V. Mechanism of oligonucleotideuptake by cells: Involvement of specific receptors? Proc. Natl. Acad. Sci. USA 1989, 86, 6454–6458. [CrossRef] [PubMed]38. Loke, S.; Stein, C.; Zhang, X.; Mori, K.; Nakanishi, M.; Subasinghe, C.; Cohen, J.; Neckers, L. Characterization of oligonucleotidetransport into living cells. Proc. Natl. Acad. Sci. USA 1989, 86, 3474–3478. [CrossRef]39. Kimura, Y.; Sonehara, K.; Kuramoto, E.; Makino, T.; Yamamoto, S.; Yamamoto, T.; Kataoka, T.; Tokunaga, T. Binding ofoligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN. J. Biochem.1994, 116, 991–994. [CrossRef] [PubMed]40. Ezzat, K.; Aoki, Y.; Koo, T.; McClorey, G.; Benner, L.; Coenen-Stass, A.; O’Donovan, L.; Lehto, T.; Garcia-Guerra, A.; Nordin, J.Self-assembly into nanoparticles is essential for receptor mediated uptake of therapeutic antisense oligonucleotides. Nano Lett.2015, 15, 4364–4373. [CrossRef]41. Lee, K.; Huang, Z.N.; Mirkin, C.A.; Odom, T.W. Endosomal organization of CpG constructs correlates with enhanced immuneactivation. Nano Lett. 2020, 20, 6170–6175. [CrossRef] [PubMed]42. Bode, C.; Zhao, G.; Steinhagen, F.; Kinjo, T.; Klinman, D.M. CpG DNA as a vaccine adjuvant. Expert Rev. Vaccines 2011, 10, 499–511.[CrossRef]43. Tu, A.T.T.; Hoshi, K.; Yamazaki, T. Influence of loop permutation on immunostimulatory activities of CpG oligodeoxynucleotidesforming monomeric guanine-quadruplex structures. Biomed. Res. Ther. 2022, 9, 5410–5417. [CrossRef]44. Miyoshi, D.; Karimata, H.; Sugimoto, N. Drastic effect of a single base difference between human and tetrahymena telomeresequences on their structures under molecular crowding conditions. Angew. Chem. 2005, 117, 3806–3810. [CrossRef]45. Jana, J.; Weisz, K. A Thermodynamic Perspective on Potential G-Quadruplex Structures as Silencer Elements in the MYC Promoter.Chem.–A Eur. J. 2020, 26, 17242–17251. [CrossRef]46. Garaiova, Z.; Strand, S.P.; Reitan, N.K.; Lélu, S.; Størset, S.Ø.; Berg, K.; Malmo, J.; Folasire, O.; Bjørkøy, A.; Davies, C.D.L. Cellularuptake of DNA–chitosan nanoparticles: The role of clathrin-and caveolae-mediated pathways. Int. J. Biol. Macromol. 2012, 51,1043–1051. [CrossRef]47. Chang, T.; Qi, C.; Meng, J.; Zhang, N.; Bing, T.; Yang, X.; Cao, Z.; Shangguan, D. General cell-binding activity of intramolecularG-quadruplexes with parallel structure. PLoS ONE 2013, 8, e62348. [CrossRef] [PubMed]https://doi.org/10.1021/ja801535ehttps://www.ncbi.nlm.nih.gov/pubmed/18627159https://doi.org/10.1021/acs.biomac.0c00679https://doi.org/10.1002/0471142700.nc1701s37https://doi.org/10.1007/BF02192855https://doi.org/10.3390/biom13111639https://www.ncbi.nlm.nih.gov/pubmed/38002321https://doi.org/10.1093/nar/gky757https://www.ncbi.nlm.nih.gov/pubmed/30184167https://doi.org/10.1021/acs.biochem.8b00792https://www.ncbi.nlm.nih.gov/pubmed/30234971https://doi.org/10.1002/anie.201712043https://doi.org/10.1038/s41598-018-20852-whttps://www.ncbi.nlm.nih.gov/pubmed/29402965https://doi.org/10.1002/ange.201709184https://doi.org/10.1186/1471-2172-14-12https://www.ncbi.nlm.nih.gov/pubmed/23452377https://doi.org/10.3390/ijms23031350https://doi.org/10.1073/pnas.86.17.6454https://www.ncbi.nlm.nih.gov/pubmed/2549537https://doi.org/10.1073/pnas.86.10.3474https://doi.org/10.1093/oxfordjournals.jbchem.a124658https://www.ncbi.nlm.nih.gov/pubmed/7534760https://doi.org/10.1021/acs.nanolett.5b00490https://doi.org/10.1021/acs.nanolett.0c02536https://www.ncbi.nlm.nih.gov/pubmed/32787186https://doi.org/10.1586/erv.10.174https://doi.org/10.15419/bmrat.v9i11.780https://doi.org/10.1002/ange.200462667https://doi.org/10.1002/chem.202002985https://doi.org/10.1016/j.ijbiomac.2012.08.016https://doi.org/10.1371/journal.pone.0062348https://www.ncbi.nlm.nih.gov/pubmed/23638046Biomolecules 2025, 15, 95 16 of 1648. Clua, A.; Fàbrega, C.; García-Chica, J.; Grijalvo, S.; Eritja, R. Parallel G-quadruplex structures increase cellular uptake andcytotoxicity of 5-fluoro-2′-deoxyuridine oligomers in 5-fluorouracil resistant cells. Molecules 2021, 26, 1741. [CrossRef]49. Jensen, L.T.; Posewitz, M.C.; Srinivasan, C.; Winge, D.R. Mapping of the DNA binding domain of the copper-responsivetranscription factor Mac1 from Saccharomyces cerevisiae. J. Biol. Chem. 1998, 273, 23805–23811. [CrossRef]50. Lahoud, M.H.; Ahmet, F.; Zhang, J.-G.; Meuter, S.; Policheni, A.N.; Kitsoulis, S.; Lee, C.-N.; O’Keeffe, M.; Sullivan, L.C.; Brooks,A.G. DEC-205 is a cell surface receptor for CpG oligonucleotides. Proc. Natl. Acad. Sci. USA 2012, 109, 16270–16275. [CrossRef]51. Moseman, A.P.; Moseman, E.A.; Schworer, S.; Smirnova, I.; Volkova, T.; von Andrian, U.; Poltorak, A. Mannose receptor1 mediates cellular uptake and endosomal delivery of CpG-motif containing oligodeoxynucleotides. J. Immunol. 2013, 191,5615–5624. [CrossRef] [PubMed]52. Platt, N.; Gordon, S. Scavenger receptors: Diverse activities and promiscuous binding of polyanionic ligands. Chem. Biol. 1998, 5,R193–R203. [CrossRef]53. Platt, N.; Gordon, S. Is the class A macrophage scavenger receptor (SR-A) multifunctional?—The mouse’s tale. J. Clin. Investig.2001, 108, 649–654. [CrossRef] [PubMed]54. Zani, I.A.; Stephen, S.L.; Mughal, N.A.; Russell, D.; Homer-Vanniasinkam, S.; Wheatcroft, S.B.; Ponnambalam, S. Scavengerreceptor structure and function in health and disease. Cells 2015, 4, 178–201. [CrossRef]55. Kohashi, H.; Nagata, R.; Tamenori, Y.; Amatani, T.; Ueda, Y.; Mori, Y.; Kasahara, Y.; Obika, S.; Shimojo, M. A novel transientreceptor potential C3/C6 selective activator induces the cellular uptake of antisense oligonucleotides. Nucleic Acids Res. 2024, 52,4784–4798. [CrossRef]56. De Dios, R.; Nguyen, L.; Ghosh, S.; McKenna, S.; Wright, C.J. CpG-ODN-mediated TLR9 innate immune signalling and calciumdyshomeostasis converge on the NFκB inhibitory protein IκBβ to drive IL1α and IL1β expression. Immunology 2020, 160, 64–77.[CrossRef] [PubMed]Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individualauthor(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury topeople or property resulting from any ideas, methods, instructions or products referred to in the content.https://doi.org/10.3390/molecules26061741https://doi.org/10.1074/jbc.273.37.23805https://doi.org/10.1073/pnas.1208796109https://doi.org/10.4049/jimmunol.1301438https://www.ncbi.nlm.nih.gov/pubmed/24184555https://doi.org/10.1016/S1074-5521(98)90156-9https://doi.org/10.1172/JCI200113903https://www.ncbi.nlm.nih.gov/pubmed/11544267https://doi.org/10.3390/cells4020178https://doi.org/10.1093/nar/gkae245https://doi.org/10.1111/imm.13182https://www.ncbi.nlm.nih.gov/pubmed/32064589 Introduction  Materials and Methods  ODNs  G4 Structure Formation  Circular Dichroism Spectroscopy  Polyacrylamide Gel Electrophoresis (PAGE)  Size Exclusion Chromatography (SEC-HPLC)  Purity Analysis via NMR  Serum Stability Assay  Cell Culture  Quantification of Immunostimulatory Activity  Quantification of Cellular Uptake  Confocal Microscopy  Immunoprecipitation Assay  Statistical Analysis  Results  Design and Characterization of G4 CpG ODNs  Effect of G4 Topology on the Immunostimulatory Activity of CpG ODNs  Effect of G4 Topology on Thermal Stability and Nuclease Resistance  Effect of G4 Topology on Cellular Uptake of CpG ODNs  Investigation of the Uptake Receptor for G4 CpG ODNs  TLR9 Affinity of G4 CpG ODNs and Immune Response  Discussion  Conclusions  References