# Fileset

[Potential of Enzymatically Synthesi-2024-Hoshi.pdf](https://mdr.nims.go.jp/filesets/460a8432-9277-4ff7-8b5f-d9ae9210a7b3/download)

## Creator

Kazuaki Hoshi, Anh Thi Tram Tu, Miwako Shobo, Karin Kettisen, [Lei Ye](https://orcid.org/0000-0002-3646-4072), [Leif Bülow](https://orcid.org/0000-0003-4966-8610), [Yoji Hakamata](https://orcid.org/0000-0002-0138-6692), [Tetsuya Furuya](https://orcid.org/0000-0003-3979-7072), [Ryutaro Asano](https://orcid.org/0000-0001-6795-8377), [Wakako Tsugawa](https://orcid.org/0000-0001-6299-5267), [Kazunori Ikebukuro](https://orcid.org/0000-0003-2838-0562), [Koji Sode](https://orcid.org/0000-0002-9833-2091), [Tomohiko Yamazaki](https://orcid.org/0000-0003-2136-8042)

## Rights

[Creative Commons BY Attribution 4.0 International](https://creativecommons.org/licenses/by/4.0/)

## Other metadata

[Potential of Enzymatically Synthesized Hemozoin Analog as Th1 Cell Adjuvant](https://mdr.nims.go.jp/datasets/3034f9d2-7ee2-48ea-96f6-2fedba69c76c)

## Fulltext

Potential of Enzymatically Synthesized Hemozoin Analog as Th1 Cell AdjuvantCitation: Hoshi, K.; Tu, A.T.T.; Shobo,M.; Kettisen, K.; Ye, L.; Bülow, L.;Hakamata, Y.; Furuya, T.; Asano, R.;Tsugawa, W.; et al. Potential ofEnzymatically Synthesized HemozoinAnalog as Th1 Cell Adjuvant.Nanomaterials 2024, 14, 1440. https://doi.org/10.3390/nano14171440Academic Editor: Jose M. PalomoReceived: 9 July 2024Revised: 20 August 2024Accepted: 30 August 2024Published: 3 September 2024Copyright: © 2024 by the authors.Licensee MDPI, Basel, Switzerland.This article is an open access articledistributed under the terms andconditions of the Creative CommonsAttribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).nanomaterialsArticlePotential of Enzymatically Synthesized Hemozoin Analog as Th1Cell AdjuvantKazuaki Hoshi 1, Anh Thi Tram Tu 1,2,3, Miwako Shobo 1, Karin Kettisen 4, Lei Ye 4 , Leif Bülow 4,* ,Yoji Hakamata 5 , Tetsuya Furuya 6 , Ryutaro Asano 7 , Wakako Tsugawa 7 , Kazunori Ikebukuro 7 ,Koji Sode 8 and Tomohiko Yamazaki 1,9,*1 Research Center for Macromolecules and Biomaterials, National Institute for Materials Science (NIMS),Tsukuba 305-0047, Japan; tttanh@hcmus.edu.vn (A.T.T.T.); shobo.miwako@nims.go.jp (M.S.)2 Department of Magnetic and Biomedical Materials, Faculty of Materials Science and Technology, Universityof Science, Ho Chi Minh City 70000, Vietnam3 Ho Chi Minh City Campus, Vietnam National University, Ho Chi Minh City 70000, Vietnam4 Division of Pure and Applied Biochemistry, Department of Chemistry, Lund University, 22100 Lund, Sweden;karinkettisen@gmail.com (K.K.); lei.ye@tbiokem.lth.se (L.Y.)5 School of Veterinary Nursing and Technology, Nippon Veterinary and Life Science University, Musashino180-8602, Japan; yhakama@nvlu.ac.jp6 Cooperative Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture andTechnology, Fuchu 183-8509, Japan; furuyat@cc.tuat.ac.jp7 Department of Biotechnology and Life science, Graduate School of Engineering, Tokyo University ofAgriculture and Technology, Koganei 184-8588, Japan; ryutaroa@cc.tuat.ac.jp (R.A.);tsugawa@cc.tuat.ac.jp (W.T.); ikebu@cc.tuat.ac.jp (K.I.)8 Joint Department of Biomedical Engineering, The University of North Carolina at Chapel Hill and NorthCarolina State University, Chapel Hill, NC 27599, USA; ksode@email.unc.edu9 Graduate School of Life Science, Hokkaido University, Sapporo 060-0808, Japan* Correspondence: leif.bulow@kilu.lu.se (L.B.); yamazaki.tomohiko@nims.go.jp (T.Y.)Abstract: Hemozoin (Hz) is a heme crystal produced during malaria infection that stimulates immunecells, leading to the production of cytokines and chemokines. The immunostimulatory action of Hzhas previously been applied in the development of alternative adjuvants. Crystallization of hemin isa chemical approach for producing Hz. Here, we focused on an enzymatic production method for Hzusing the heme detoxification protein (HDP), which catalyzes heme dimer formation from hemin inPlasmodium. We examined the immunostimulatory effects of an enzymatically synthesized analogof Hz (esHz) produced by recombinant Plasmodium falciparum HDP. Enzymatically synthesized Hzstimulates a macrophage cell line and human peripheral mononuclear cells, leading to the productionof interleukin (IL)-6 and IL-12p40. In mice, subcutaneous administration of esHz together with anantigen, ovalbumin (OVA), increased the OVA-specific immunoglobulin (Ig) G2c isotype level in theserum, whereas OVA-specific IgG1 was not induced. Our findings suggest that esHz is a useful Th-1cell adjuvant.Keywords: hemozoin analog; heme detoxification protein; adjuvant; vaccine; Th-1 immunity1. IntroductionHeme detoxification protein (HDP) is a heme ligase that plays an essential role inthe formation of the malarial pigment hemozoin (Hz) during the erythrocytic stage ofPlasmodium parasites. Plasmodium digests hemoglobin, which is abundant in erythrocytes,to obtain nutrients essential for its growth. This process is accompanied by the release offree heme, which is toxic to Plasmodium because it oxidizes parasitic DNA and lipids [1].During the degradation of hemoglobin, HDP binds to toxic-free heme and converts themto non-toxic heme crystals, such as Hz. Heme detoxification protein was first identified inPlasmodium falciparum, and orthologs have been found in seven other Plasmodium species [2].Nanomaterials 2024, 14, 1440. https://doi.org/10.3390/nano14171440 https://www.mdpi.com/journal/nanomaterialshttps://doi.org/10.3390/nano14171440https://doi.org/10.3390/nano14171440https://creativecommons.org/https://creativecommons.org/licenses/by/4.0/https://creativecommons.org/licenses/by/4.0/https://www.mdpi.com/journal/nanomaterialshttps://www.mdpi.comhttps://orcid.org/0000-0002-3646-4072https://orcid.org/0000-0003-4966-8610https://orcid.org/0000-0002-0138-6692https://orcid.org/0000-0003-3979-7072https://orcid.org/0000-0001-6795-8377https://orcid.org/0000-0001-6299-5267https://orcid.org/0000-0003-2838-0562https://orcid.org/0000-0002-9833-2091https://orcid.org/0000-0003-2136-8042https://doi.org/10.3390/nano14171440https://www.mdpi.com/journal/nanomaterialshttps://www.mdpi.com/article/10.3390/nano14171440?type=check_update&version=1Nanomaterials 2024, 14, 1440 2 of 13The HDP reaction mechanism was studied using recombinant HDP [2–5]. A previous reportindicated that HDP is the most potent enzyme for converting heme to Hz among otheravailable Hz producers, such as lipids and histidine-rich protein II.Natural Hz is not only a metabolite but also activates immune cells during malariainfection. After heme detoxification, Hz is released into the bloodstream upon the ruptureof erythrocytes and subsequently accumulates in the reticuloendothelial system of the host(i.e., macrophages, leukocytes, and tissues, such as the liver and spleen), resulting in aninflammatory response by the host’s immune system [6–15]. It induces the production ofcytokines and chemokines, such as interleukin (IL)-6, IL-12, IL-8, tumor necrosis factor-α, and monocyte chemoattractant protein 1 from dendritic cells and macrophages [7].Accumulation of Hz in tissues is associated with disease severity in malaria-infectedpatients and mice [7,16,17].Innate immune receptors, such as Toll-like receptors (TLRs) [6], C-type lectin recep-tors [18], and nucleotide-binding oligomerization domain-like receptors (NLRs) [8], mayrecognize natural Hz and mediate immune responses. A chemically synthesized analogof Hz (csHz) is produced from hemin using an acid-catalyzed method and is structurallyidentical to natural Hz comprising heme dimers [19]. The generated csHz can also inducethe production of pro-inflammatory cytokines, such as IL-6, IL-1α, and IL-1β [8].Natural Hz and csHz were prepared by recovery from erythrocytes infected withPlasmodium and crystallization of chemically produced hemin, respectively. However, thereare no reports on the application of Hz synthesis in vitro using an enzymatic HDP reaction.The conversion ratio of heme to Hz by recombinant Plasmodium falciparum HDP (PfHDP)was comparable to that of native HDP [2]. Therefore, the enzymatic reaction of PfHDP maybe applicable for the preparation of Hz analogs that function as adjuvant molecules.Here, we hypothesized that an enzymatically synthesized analog of Hz (esHz) pro-duced by recombinant PfHDP using hemin as a substrate could have immunostimulatoryeffects and act as an adjuvant, similar to csHz [7].The esHz synthesized by recombinant HDP showed a hydrodynamic size of 350 nm,which is similar to that of natural Hz. Enzymatically synthesized Hz induced 27- and5-fold higher levels of IL-6 and interferon (IFN)-γ, respectively, in human peripheral bloodmononuclear cells (PBMCs) than csHz. Subcutaneous administration of esHz together withthe model antigen ovalbumin (OVA) increased antigen-specific immunoglobulin (Ig) G2cproduction in the blood six-fold compared to alum with OVA at six weeks after the secondvaccination. Additionally, esHz tended to induce OVA-specific IgG2c more selectively thanIgG1, resulting in the induction of a Th-1 cell immune reaction. This study clearly indicatesthat esHz produced by recombinant PfHDP can be useful for the production of a vaccineadjuvant to induce Th-1 cell immunity.2. Materials and Methods2.1. ReagentsChaperone-competent cells, pG-Tf2/BL21 and pCold IV, for cold shock-induced pro-tein expression in E. coli were purchased from Takara Bio (Shiga, Japan). Hemin was ob-tained from the Tokyo Chemical Industry (Tokyo, Japan). HisTrapTM HP and HiTrapTM QHP columns were acquired from Cytiva (Marlboro, MA, USA). His-tagged monoclonal anti-bodies were purchased from Novagen (Madison, WI, USA). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG was obtained from DakoCytomation (Glostrup, Denmark).Phosphorothioate-modified CpG ODN 2006 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′)was synthesized by Fasmac (Kanagawa, Japan). Phosphorothioate-modified CpG ODN K3(5′-ATCGACTCTCGAGCGTTCTC-3′) was purchased from GeneDesign (Osaka, Japan).2.2. Expression and Purification of HDPTo express HDP with a hexahistidine tag at the C-terminus, synthetic, full-length, codon-optimized DNA of PfHDP (GenBank Acc# NP_702335) was synthesized by Eurofins Genomics(Tokyo, Japan). The HDP gene fragment was inserted into the HindIII/NdeI site of the pColdNanomaterials 2024, 14, 1440 3 of 13IV vector to generate pCold IV-PfHDP. Escherichia coli pG-Tf2/BL21 competent cells expressGroEL, GroES, and trigger factor (Tf) under the control of the tetracycline-inducible promoter(Pzt-1). Competent cells transformed with either pCold IV or pCold IV-PfHDP were grown in100 mL of Luria–Bertani liquid medium supplemented with 20 µg/mL chloramphenicol and100 µg/mL carbenicillin, with or without the addition of 10 ng/mL tetracycline. Escherichia colicells were cultured at 37 ◦C until the OD590 reached 0.4, and they were then incubated at 15 ◦Cfor 30 min. Isopropyl-β-D-thiogalactopyranoside (IPTG, 0.1 mM) was subsequently added tothe medium, and the cells were cultured at 15 ◦C for another 24 h. The PfHDP was purifiedas described previously, with slight modifications [2]. The cell pellet was sonicated in 50 mMN-cyclohexyl-3-aminopropanesulfonic acid (CAPS) buffer (pH 11.0) containing 0.3% (w/v)N-lauroylsarcosine and 0.3 M NaCl. The soluble proteins were separated by centrifugation at12,000× g at 4 ◦C for 20 min. The soluble proteins were applied to a HisTrapTM HP columnequilibrated with 50 mM CAPS (pH 11.0) containing 0.3% (w/v) N-lauroylsarcosine and0.3 M NaCl and eluted with a linear imidazole gradient ranging between 0 and 200 mM inthe same buffer. The fractions containing PfHDP were dialyzed against 50 mM CAPS (pH11.0) containing 0.3% (w/v) N-lauroylsarcosine and applied to a HiTrapTM Q HP column.The proteins were eluted with a linear NaCl gradient in 50 mM CAPS (pH 11.0) containing0.3% (w/v) N-lauroylsarcosine. Fractions containing HDP were dialyzed against 25 mMCAPS (pH 11.0) containing 135 mM NaCl. The purity of the eluted proteins was examined bysodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Histidine-taggedPfHDP was detected by Western blotting with a monoclonal antibody against the His-tag andpolyclonal goat anti-mouse immunoglobulins/HRP. The concentration of the purified PfHDPwas determined using a BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).2.3. esHz Formation AssayThe Hz formation assay used to quantify esHz was performed as previously de-scribed [4]. The PfHDP concentration for the assay was estimated using the BCA proteinassay kit, and an estimated extinction coefficient of 36.0 mM−1 cm−1 for sample absorbanceat 280 nm [4]. The PfHDP (0.13 mg, 5 µM) was incubated with hemin (0.39 mg, 600 µM) in0.5 M sodium acetate (pH 4.8) at 37 ◦C for 1 h on an orbital shaker at 500 rpm. Lysozyme(0.13 mg) was used as a negative control for PfHDP. The reaction was stopped by adding0.1% (w/v) SDS. The pellet was collected by centrifugation at 15,000× g for 10 min andwashed three times with 2.5% (w/v) SDS and 0.1 M sodium bicarbonate (pH 9.1). Afterwashing three times with Milli-Q water, the pellet was lyophilized. To determine theconcentration of hemin converted by PfHDP, the washed pellet was dissolved in 0.1 MNaOH. The concentration of hemin was calculated by using an extinction coefficient of58.4 mM−1 cm−1 by monitoring the absorbance at 385 nm [4].2.4. csHz PreparationA previously described protocol was used to synthesize csHz [11]. Briefly, hemin(45 mg) was dissolved in 4.5 mL of 1 N NaOH and mixed with 450 µL of 1 N HCl in aflask. The flask was placed in an oil bath heated at 60 ◦C, and 10.2 mL of 1 M sodiumacetate (pH 4.8) was gradually added with stirring. After centrifugation at 12,000× g for20 min, the pellet was washed three times with 2.5% (w/v) SDS, followed by the washingwith 0.1 M sodium bicarbonate (pH 9.1) four times. The pellet was lyophilized for furtheranalysis.2.5. Generation of Infra-Red (IR) Spectra and Scanning Electron Microscope (SEM) ImagesAttenuated total reflection Fourier transform IR (ATR-FTIR) spectroscopy was used tocharacterize the esHz. The ATR-FTIR spectra of esHz, csHz, and hemin were measuredusing an IRTracer-100 (Shimadzu, Kyoto, Japan) equipped with an ATR accessory (QuestATR; Specac, Kent, UK). Images of the pellets were obtained by SEM (S-4800, HitachiHigh-Tech, Tokyo, Japan). The acceleration voltage was set at 12 kV. The size distributionNanomaterials 2024, 14, 1440 4 of 13was analyzed by dynamic light scattering (DLS-8000, Otsuka Electronics, Osaka, Japan)using a He-Ne laser (633 nm).2.6. Mammalian Cell Culture and ImmunostimulationThe murine macrophage cell line (RAW264) was purchased from the RIKEN BioRe-source Center (Tsukuba, Japan). The RAW264 cells were cultured in minimum essentialmedium (MEM) supplemented with 10% (v/v) fetal bovine serum, 100 unit/mL peni-cillin, 100 µg/mL streptomycin (P/S), and 1% (v/v) non-essential amino acid solution(Wako Pure Chemical Industries, Osaka, Japan). The cells were seeded in 96 well-plates at5 × 104 cells/well and cultured at 37 ◦C in a humidified incubator with 5% CO2 for 24 h.The cells were incubated with csHz, esHz (50 µg/mL), phosphorothioate-modified CpGODNs (4 µM), and sterilized deionized water as a control for 24 h. Commercially availablefrozen PBMCs were purchased from Cellular Technology Limited (Shaker Heights, OH,USA). The PBMCs were thawed according to the manufacturer’s instructions, seeded in a96-well plate at a density of 1 × 106 cells/well, and stimulated with csHz, esHz (50 µg/mL),phosphorothioate-modified CpG ODN K3 (1 µM), or sterilized deionized water at 37 ◦Cin a humidified incubator containing 5% CO2 for 48 h. After the stimulation, the culturemedium was collected. The levels of induced cytokine mRNAs and secreted cytokines wereevaluated using real-time reverse transcription-quantitative polymerase chain reaction(RT-qPCR) and enzyme-linked immunosorbent assay (ELISA), respectively.2.7. RT-qPCR and ELISAThe relative transcript levels of cytokines in the RAW264 cells were examined using RT-qPCR. Total RNA was extracted from the cells using ISOGEN (Nippon Gen, Tokyo, Japan)following the manufacturer’s instructions. Before being converted to cDNA by reversetranscriptase (Takara Bio), extracted RNA underwent a genomic DNA digestion step withRNase-Free DNase (Takara Bio). Interleukin-6, IL-12, and IFN-β transcripts were measuredusing RT-qPCR conducted on LightCycler® 480 System II (Roche, Basel, Switzerland) usingSYBR Green MasterMix (Roche) and the primers listed in Table 1. Amplification wasconducted with 50 ng cDNA in a total reaction volume of 15 µL for 45 cycles, 10 s each at95 ◦C, 60 ◦C, and 72 ◦C. After the PCR, the “crossing point” (Cp) value, that is, the cycleat which the fluorescence of a sample becomes significantly higher than the backgroundfluorescence, was determined. The mRNA expression levels were normalized to thoseof glyceraldehyde 3-phosphate dehydrogenase, a housekeeping gene. The specificity ofthe amplified products was determined by analyzing their melting curves. The levels ofIL-6 and IFN-γ secreted into the medium collected from PBMCs were determined usingReady-Set-Go! The ELISA kits (Thermo Fisher Scientific) were used according to themanufacturer’s instructions.Table 1. Primer sequence for analysis of murine cytokines.Gene Sequence (5′-3′)GAPDH FW: GTGGACCTCATGGCCTACATRV: TGTGAGGGAGATGCTCAGTGIL-6 FW: TCCTTCCTACCCCAATTTCCRV: CGCACTAGGTTTGCCGAGTAIL-12 FW: GAAAGGCTGGGTATCGGRV: GGCTGTCCTCAAACTCACIFN-β FW: GGTCCGAGCAGAGATCTTCARV: TCACTACCAGTCCCAGAGTCCFW: forward primer; RV: reverse primer; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; IL: interleukin;IFN: interferon.2.8. Administration of OVA with esHz in Mice and Measurement of OVA-Specific IgG LevelMale C57BL/6 mice (Charles River Laboratories Japan, Yokohama, Japan) were housedin a pathogen-free environment for one week before the start of the experiment. All proto-Nanomaterials 2024, 14, 1440 5 of 13cols were approved by the Animal Care and Use Committee of the National Institute forMaterials Science according to the Guidelines for Proper Conduct of Animal Experimentsestablished by the Science Council of Japan. For in vivo immunostimulatory experiments,9-week-old mice were injected intraperitoneally with 500 µg of either alum or esHz fol-lowing the serum collection at 4 h after injection. For vaccination, 200 µL of a solutioncontaining OVA (200 µg) and with either alum (500 µg) or esHz (500 µg) was injectedsubcutaneously into the back of 6-week-old mice. Vaccination was conducted twice atone-week intervals, and the mice were boosted with OVA (200 µg) at six weeks after thesecond dose. Blood samples were collected every other week from the vascular bundlejust above the posterior mandible using an animal lancet (MEDIpoint, Mineola, NY, USA).Blood was placed in Torch tubes (Satokasei, Tochigi, Japan) containing coagulation reagentand separation gel, and serum was separated by centrifugation at 3000× g for 10 min at4 ◦C. Serum was stored at −20 ◦C until ELISA. Ovalbumin-specific levels of IgG1, IgG2c,and total IgE were measured using ELISA as previously described [20].2.9. Statistical AnalysisStatistical significance was evaluated using a one-way analysis of variance, followed byTukey’s multiple comparison test. All statistical analyses were performed using GraphPadPrism version 8.2.0 Windows (GraphPad Software, La Jolla, CA, USA).3. Results3.1. Cold-Shock with Co-Expression of Chaperones Improves the Solubility of PfHDPFigure 1A summarizes the expression and purification of PfHDP. In a previous study,recombinant HDPs were prepared from inclusion bodies via refolding [2]. Here, weattempted to express PfHDP using the cold shock expression method with the co-expressionof chaperones to improve the solubility of PfHDP. Figure 1B shows the expression levels ofPfHDP in soluble and insoluble fractions. The thick bands between the molecular weightmarkers of 47,300 and 84,700 Da correspond to the co-expressed Tf (~56,000) and GroEL(~60,000) proteins, respectively. His-tagged PfHDP has a molecular weight of approximately25,000 Da [2]. The co-expression of chaperones increased the solubility of PfHDP in contrastto cold shock expression alone (Figure 1C). The expressed PfHDP was purified using Ni-NTA affinity chromatography followed by anion-exchange chromatography. After treatingthe samples with dithiothreitol, the purity of each eluted fraction was examined usingSDS-PAGE (Figure 1D). A band corresponding to PfHDP was observed in the fractioneluted by anion-exchange chromatography. Finally, 0.83 mg of the purified PfHDP wasobtained from 200 mL of culture medium.The ability of PfHDP to convert heme into esHz was evaluated using a Hz formationassay. An aliquot of 5 µM PfHDP was mixed with 600 µM hemin at 37 ◦C in 0.5 M sodiumacetate (pH 4.8) for 1 h. The esHz was purified by washing three times with 2.5% (w/v) SDS,0.1 M sodium bicarbonate (pH 9.1), and Milli-Q water to remove PfHDP and unreactedhemin. A black precipitate was obtained (Figure 2A).The pellet was then subjected to IR spectroscopy (Figure 2B). The IR spectra of esHzand commercial csHz showed peaks at 1206 and 1661 cm−1, corresponding to the C–O andC=O stretching vibrations of the heme carboxylate group, respectively [5]. These peaks areabsent in the hemin spectra. The amount of hemin converted by PfHDP was 202 ± 20 µM(Figure 2C). Purified HDP converted 34% hemin into esHz. This is in agreement with aprevious study, which showed that refolded PfHDP (5 µM) can convert almost 30% hemininto Hz [4]. The size distribution of esHz was analyzed by dynamic light scattering, whichshowed a single peak around 350 ± 160 nm (polydispersity index: 0.23), as demonstratedin Figure 2D. The SEM images at esHz are shown in Figure 2E. These results verified thatsoluble PfHDP has similar potency in converting hemin into Hz as refolded PfHDP, asshown previously [4,5].Nanomaterials 2024, 14, 1440 6 of 13Nanomaterials 2024, 14, x FOR PEER REVIEW 6 of 13    Figure 1. Expression and purification of PfHDP in E. coli. (A) Schematic diagram of PfHDP expres-sion in E. coli and purification by chromatography. The BL21 cells co-transfected with pCold IV-PfHDP and pG-TF were grown in the medium either without (-) or with (+) the addition of tetracy-cline, followed by protein induction by cold shock expression. The expression levels of PfHDP in either the soluble (S) or insoluble (P) fraction were analyzed by (B) SDS-PAGE and (C) Western blotting analysis. Lane M, protein molecular weight marker. (D) The purity of PfHDP in the frac-tions eluted by Ni-NTA and anion exchange chromatography was estimated by SDS-PAGE. Lane M, protein molecular weight marker; Lane 1, soluble fractions of the lysate; Lane 2, samples eluted from HisTrapTM Ni-NTA column; Lane 3, samples eluted from HiTrapTM Q HP anion-exchange col-umn. The ability of PfHDP to convert heme into esHz was evaluated using a Hz formation assay. An aliquot of 5 µM PfHDP was mixed with 600 µM hemin at 37 °C in 0.5 M sodium acetate (pH 4.8) for 1 h. The esHz was purified by washing three times with 2.5% (w/v) SDS, 0.1 M sodium bicarbonate (pH 9.1), and Milli-Q water to remove PfHDP and unre-acted hemin. A black precipitate was obtained (Figure 2A). Figure 1. Expression and purification of PfHDP in E. coli. (A) Schematic diagram of PfHDP expressionin E. coli and purification by chromatography. The BL21 cells co-transfected with pCold IV-PfHDP andpG-TF were grown in the medium either without (-) or with (+) the addition of tetracycline, followedby protein induction by cold shock expression. The expression levels of PfHDP in either the soluble(S) or insoluble (P) fraction were analyzed by (B) SDS-PAGE and (C) Western blotting analysis. LaneM, protein molecular weight marker. (D) The purity of PfHDP in the fractions eluted by Ni-NTA andanion exchange chromatography was estimated by SDS-PAGE. Lane M, protein molecular weightmarker; Lane 1, soluble fractions of the lysate; Lane 2, samples eluted from HisTrapTM Ni-NTAcolumn; Lane 3, samples eluted from HiTrapTM Q HP anion-exchange column.Nanomaterials 2024, 14, 1440 7 of 13Nanomaterials 2024, 14, x FOR PEER REVIEW 7 of 13    Figure 2. Qualification of an enzymatically synthesized analog of hemozoin (esHz) produced by recombinant PfHDP. (A) An overview of the formation of esHz from hemin by PfHDP and purifi-cation step. (B) The quality of esHz was estimated by measuring IR spectra. (C) The amount of con-verted hemin by PfHDP was calculated by monitoring the absorbance at 385 nm [4]. The Hz for-mation assay was repeated three times. Data are expressed as the mean ± standard deviation (n = 3). (D) Particle size distribution of esHz measured by dynamic light scattering analysis. (E) Scanning electron microscopy (SEM) image of esHz. Scale bars, 500 nm. The pellet was then subjected to IR spectroscopy (Figure 2B). The IR spectra of esHz and commercial csHz showed peaks at 1206 and 1661 cm−1, corresponding to the C–O and Figure 2. Qualification of an enzymatically synthesized analog of hemozoin (esHz) produced byrecombinant PfHDP. (A) An overview of the formation of esHz from hemin by PfHDP and purificationstep. (B) The quality of esHz was estimated by measuring IR spectra. (C) The amount of convertedhemin by PfHDP was calculated by monitoring the absorbance at 385 nm [4]. The Hz formation assaywas repeated three times. Data are expressed as the mean ± standard deviation (n = 3). (D) Particlesize distribution of esHz measured by dynamic light scattering analysis. (E) Scanning electronmicroscopy (SEM) image of esHz. Scale bars, 500 nm.Nanomaterials 2024, 14, 1440 8 of 133.2. esHz Induces Immunostimulatory Cytokine Production in RAW264 Cells and PBMCsThe immunostimulatory effects of esHz were evaluated in RAW264 cells and humanPBMCs. Enzymatically synthesized Hz-activated RAW264 cells to induce the transcriptionof IL-6, IL-12, and IFN-β (Figure 3A). The mRNA levels of IL-6 and IL-12 induced byesHz were almost 16- and 5-fold higher than those induced by csHz, respectively. We alsoexamined the effects of esHz on primary human immune cells (PBMCs). The levels of IL-6and IFN-γ induced were significantly higher than those induced by csHz or by CpG-ODNK3, an agonist of TLR9, in PBMCs (Figure 3B). CpG-ODN K3 and CpG ODN 2006 arephosphorothioate-modified CpG-ODNs, which are potent adjuvants. These results indicatethat esHz significantly induced the production of immunostimulatory cytokines in bothmurine RAW264 cells and human PBMCs.Nanomaterials 2024, 14, x FOR PEER REVIEW 8 of 13   C=O stretching vibrations of the heme carboxylate group, respectively [5]. These peaks are absent in the hemin spectra. The amount of hemin converted by PfHDP was 202 ± 20 µM (Figure 2C). Purified HDP converted 34% hemin into esHz. This is in agreement with a previous study, which showed that refolded PfHDP (5 µM) can convert almost 30% hemin into Hz [4]. The size distribution of esHz was analyzed by dynamic light scattering, which showed a single peak around 350 ± 160 nm (polydispersity index: 0.23), as demonstrated in Figure 2D. The SEM images at esHz are shown in Figure 2E. These results verified that soluble PfHDP has similar potency in converting hemin into Hz as refolded PfHDP, as shown previously [4,5]. 3.2. esHz Induces Immunostimulatory Cytokine Production in RAW264 Cells and PBMCs The immunostimulatory effects of esHz were evaluated in RAW264 cells and human PBMCs. Enzymatically synthesized Hz-activated RAW264 cells to induce the transcription of IL-6, IL-12, and IFN-β (Figure 3A). The mRNA levels of IL-6 and IL-12 induced by esHz were almost 16- and 5-fold higher than those induced by csHz, respectively. We also ex-amined the effects of esHz on primary human immune cells (PBMCs). The levels of IL-6 and IFN-γ induced were significantly higher than those induced by csHz or by CpG-ODN K3, an agonist of TLR9, in PBMCs (Figure 3B). CpG-ODN K3 and CpG ODN 2006 are phosphorothioate-modified CpG-ODNs, which are potent adjuvants. These results indi-cate that esHz significantly induced the production of immunostimulatory cytokines in both murine RAW264 cells and human PBMCs.  Figure 3. Cytokine induction by an enzymatically synthesized analog of hemozoin (esHz) fromRAW264 murine macrophage cells and human peripheral blood mononuclear cells (PBMCs). (A) Theinduction of cytokines from RAW264 was evaluated using real-time reverse transcriptase-quantitativePCR (RT-qPCR) analysis. The Raw264 cells were incubated with esHz (50 µg/mL), chemicallysynthesized analog of Hz (csHz) (50 µg/mL), and with phosphorothioate-modified CpG ODNs,K3 and 2006 (1 µM) for 24 h. Data are expressed as the mean ± standard deviation (SD) (n = 5).The relative mRNA level compared to the control was calculated. (B) Immunostimulatory cytokineproductions from human PBMC were evaluated using an enzyme-linked immunosorbent assay.Human PBMCs were stimulated with esHz (50 µg/mL), csHz (50 µg/mL), and phosphorothioate-modified CpG ODN (1 µM) for 48 h. Data are expressed as the mean ± SD (n = 5).Nanomaterials 2024, 14, 1440 9 of 133.3. esHz Induces the Cytokines and OVA-Specific IgG Induction in MiceWe first evaluated whether esHz alone stimulated innate immunity in mice. Alum,which is already used as an adjuvant in several vaccines, was used as a control. In previousreports, maximum cytokine production was observed 2–4 h after the injection of TLR9agonists in mice [15,21]. Therefore, mouse blood was collected 4 h after esHz or alumadministration, and cytokine levels were quantified. Enzymatically stimulated analog of Hztreatment induced the production of IL-6 (Figure 4A) and IL-12p40 (Figure 4B). Particularly,the level of IL-6 induced by esHz was higher than that induced by alum alone. Next, weexamined the adjuvant effect of esHz on OVA as an antigen in mice and measured the levelsof OVA-specific IgG1 and IgG2c in the serum. Figure 5 shows the OVA-specific IgG1 andIgG2c levels in the serum at two and six weeks after the second vaccination and two weeksafter the boost. Vaccination with alum, an adjuvant molecule in practical use, inducedOVA-specific IgG1 expression at all periods. In contrast, the OVA-specific IgG2c levelsin the serum of mice injected with esHz as an adjuvant were higher than those in miceinjected with OVA alone or a mixture of OVA and alum. Mice vaccinated with esHz as anadjuvant showed higher levels of OVA-specific IgG2c than those vaccinated with alum asan adjuvant at all time points after the second vaccination. Ovalbumin-specific IgG2c levelsin mice vaccinated with a mixture of OVA and esHz gradually increased until six weeksafter the second dose (Supplementary Figure S1). A significant increase in OVA-specificIgG2c levels in the serum of mice vaccinated with esHz as an adjuvant was also observedin a booster experiment with OVA after vaccine administration.Nanomaterials 2024, 14, x FOR PEER REVIEW 9 of 13   Figure 3. Cytokine induction by an enzymatically synthesized analog of hemozoin (esHz) from RAW264 murine macrophage cells and human peripheral blood mononuclear cells (PBMCs). (A) The induction of cytokines from RAW264 was evaluated using real-time reverse transcriptase-quan-titative PCR (RT-qPCR) analysis. The Raw264 cells were incubated with esHz (50 µg/mL), chemi-cally synthesized analog of Hz (csHz) (50 µg/mL), and with phosphorothioate-modified CpG ODNs, K3 and 2006 (1 µM) for 24 h. Data are expressed as the mean ± standard deviation (SD) (n = 5). The relative mRNA level compared to the control was calculated. (B) Immunostimulatory cytokine pro-ductions from human PBMC were evaluated using an enzyme-linked immunosorbent assay. Hu-man PBMCs were stimulated with esHz (50 µg/mL), csHz (50 µg/mL), and phosphorothioate-mod-ified CpG ODN (1 µM) for 48 h. Data are expressed as the mean ± SD (n = 5). 3.3. esHz Induces the Cytokines and OVA-Specific IgG Induction in Mice We first evaluated whether esHz alone stimulated innate immunity in mice. Alum, which is already used as an adjuvant in several vaccines, was used as a control. In previous reports, maximum cytokine production was observed 2–4 h after the injection of TLR9 agonists in mice [15,21]. Therefore, mouse blood was collected 4 h after esHz or alum ad-ministration, and cytokine levels were quantified. Enzymatically stimulated analog of Hz treatment induced the production of IL-6 (Figure 4A) and IL-12p40 (Figure 4B). Particu-larly, the level of IL-6 induced by esHz was higher than that induced by alum alone. Next, we examined the adjuvant effect of esHz on OVA as an antigen in mice and measured the levels of OVA-specific IgG1 and IgG2c in the serum. Figure 5 shows the OVA-specific IgG1 and IgG2c levels in the serum at two and six weeks after the second vaccination and two weeks after the boost. Vaccination with alum, an adjuvant molecule in practical use, in-duced OVA-specific IgG1 expression at all periods. In contrast, the OVA-specific IgG2c levels in the serum of mice injected with esHz as an adjuvant were higher than those in mice injected with OVA alone or a mixture of OVA and alum. Mice vaccinated with esHz as an adjuvant showed higher levels of OVA-specific IgG2c than those vaccinated with alum as an adjuvant at all time points after the second vaccination. Ovalbumin-specific IgG2c levels in mice vaccinated with a mixture of OVA and esHz gradually increased until six weeks after the second dose (Supplementary Figure S1). A significant increase in OVA-specific IgG2c levels in the serum of mice vaccinated with esHz as an adjuvant was also observed in a booster experiment with OVA after vaccine administration. The dose ratio of OVA-specific IgG2c to OVA-specific IgG1 in mice vaccinated with esHz as an adjuvant was 28- and 20-fold higher than that in mice vaccinated with alum at six and two weeks after the second vaccination and boost, respectively. The results showed that esHz induced OVA-specific IgG2c more selectively than OVA-specific IgG1. Additionally, esHz vaccination was not accompanied by the induction of OVA-specific IgE, an indicator of vaccination side effects (Supplementary Figure S2). These results in-dicated that esHz induces Th-1 cell immune responses.  Figure 4. In vivo cytokine inductions in mouse serum by enzymatically synthesized analog ofhemozoin (esHz). Interleukin (IL)-6 (A) and IL-12p40 (B) concentrations in mouse serum afterintraperitoneal injection of esHz or alum. Mice received an injection of materials at a dose of500 µg/mouse, and blood was collected at 4 h after the injection. Serum concentrations of IL-6 andIL-12p40 were measured using enzyme-linked immunosorbent assays. Results are expressed as themean ± standard deviation of six mice. Data are representative of two independent experiments.The dose ratio of OVA-specific IgG2c to OVA-specific IgG1 in mice vaccinated withesHz as an adjuvant was 28- and 20-fold higher than that in mice vaccinated with alumat six and two weeks after the second vaccination and boost, respectively. The resultsshowed that esHz induced OVA-specific IgG2c more selectively than OVA-specific IgG1.Additionally, esHz vaccination was not accompanied by the induction of OVA-specific IgE,an indicator of vaccination side effects (Supplementary Figure S2). These results indicatedthat esHz induces Th-1 cell immune responses.Nanomaterials 2024, 14, 1440 10 of 13Nanomaterials 2024, 14, x FOR PEER REVIEW 10 of 13   Figure 4. In vivo cytokine inductions in mouse serum by enzymatically synthesized analog of hemo-zoin (esHz). Interleukin (IL)-6 (A) and IL-12p40 (B) concentrations in mouse serum after intraperi-toneal injection of esHz or alum. Mice received an injection of materials at a dose of 500 µg/mouse, and blood was collected at 4 h after the injection. Serum concentrations of IL-6 and IL-12p40 were measured using enzyme-linked immunosorbent assays. Results are expressed as the mean ± stand-ard deviation of six mice. Data are representative of two independent experiments.  Figure 5. Ovalbumin (OVA)-specific IgG2c is induced by an enzymatically synthesized analog ofhemozoin (esHz). The levels of OVA-specific IgG2c (OVA-IgG2c) and OVA-specific IgG1 (OVA-IgG1)and the ratio of OVA-IgG2c to OVA-IgG1 induced by either esHz or alum adjuvant at two (i), six (ii),and eight weeks (iii) after the second vaccination. Serum collected from immunized mice was usedfor enzyme-linked immunosorbent assay. Results are expressed as the mean ± standard deviation(n = 10 to 12). # The levels of OVA-IgG2c were lower than the detectable minimum of 0.39 ng/mL.Nanomaterials 2024, 14, 1440 11 of 134. DiscussionThis study examined the immunostimulatory effects of esHz produced using recombi-nant PfHDP. In the present study, we demonstrated that esHz stimulated innate immunityin mice and induced antigen-specific IgG2c. To our knowledge, this is the first study todemonstrate that esHz can function as a Th-1 adjuvant.Previous studies have used either the pET or pCold expression systems to producePfHDPs in the form of inclusion bodies [2–4]. Although both systems produced smallamounts of solubilized PfHDP, the expression level was not high enough to allow forfurther purification [2,4]. The PfHDP was refolded in CAPS buffer (pH 11.0) containingL-arginine-HCl and oxidized glutathione [2]. In contrast, a previous study clearly indicatedthat co-expression of chaperones promoted the solubilization of PfHDP in E. coli cellscultured at 37 ◦C [22]. In this study, we examined the effects of cold shock on the co-expression of chaperones. This strategy improved the solubility of PfHDP compared tocold shock expression alone (Figure 1B). A total of 0.83 mg of the PfHDP was preparedfrom 200 mL of the Escherichia coli culture. This high yield of soluble recombinant PfHDPfrom Escherichia coli has not been previously reported.Hemozoin was conducted in the digestive vacuole of Plasmodium under acidic con-ditions. The particle size of natural Hz varies among Plasmodium species [23]. All fourPlasmodium falciparum clones produced natural Hz with average dimensions of approxi-mately 100 × 100 × 300–500 nm [23]. Natural Hz is brick-like with smooth sides at rightangles and shows much less size heterogeneity [23]. In contrast, csHz produced by hemincrystallization differs morphologically from natural Hz. The size of csHz has a widerdistribution than natural Hz, with particle sizes in the range of 50 nm to 20 µm [6]. ThecsHz has tapered ends and radiates in different directions [23]. The esHz was brick-likewith smooth sides (Figure 2D). The crystal had a size of approximately 350 nm (Figure 2C),which consisted of heme dimers (Figure 2A). The morphology of the esHz was more similarto natural Hz than that of the csHz. Additionally, esHz showed stronger immunostim-ulatory effects than csHz (Figure 3). Therefore, esHz is an analog molecule of Hz thatpossesses morphological and immunostimulatory characteristics similar to those of naturalHz. The differences in immunostimulatory properties between natural Hz and csHz remaincontroversial. The crystal size of csHz is dependent on synthetic methods and tends tocause a diverse distribution of its size from 50 to 20 µm [6]. In contrast, DLS analysis ofesHz showed a narrower distribution of crystal size from 100 nm to 1 µm (Figure 2C). Thecrystal size of Hz might be the reason for the difference in immunostimulatory properties(Figure 3). Several innate immune receptors, such as TLRs and NLRs, are involved inthe recognition of natural Hz [6,8,18]. Heme, a component of Hz, stimulates TLR4 signal-ing [24]. Based on these reports, esHz may stimulate these innate immune receptors andexert immunostimulatory effects.The adjuvant effects of csHz have been demonstrated in several animal models, withcrystals in the range of 200 nm exerting the highest effects [25]. In mice, csHz inducesantigen-specific IgG production and may act as a type 2 adjuvant. In contrast, in dogand monkey models, csHz may initiate Th-1-like immune responses against malaria andallergens [6,25]. The esHz stimulated immunity and induced IL-6 and IL-12p expression(Figure 4), resulting in the production of OVA-specific IgG (Figure 5). Particularly, the levelof OVA-specific IgG2 induced by esHz was higher than that induced by alum (Figure 5).The potential of esHz as a Th-1 adjuvant was demonstrated by the lack of OVA-specific IgEinduction (Supplementary Figure S2). These results indicated that esHz can function as aTh-1 adjuvant.5. ConclusionsWe demonstrated the immunostimulatory effects and potential of esHz as a Th-1adjuvant. The esHz was enzymatically synthesized using the soluble form of recombinantPfHDP. In terms of its morphology and immunostimulatory effects, esHz has propertiessimilar to those of natural Hz. The enzymatic system based on recombinant PfHDP is a safeNanomaterials 2024, 14, 1440 12 of 13synthetic method of Hz adjuvant. The immunostimulatory effect of esHz was significantlyhigher than that of csHz in both mouse Raw264 macrophage cells and human PBMCs.In vivo experiments confirmed that esHz induces antigen-specific antibodies in mice. Inparticular, the antigen-specific IgG2c levels induced by esHz were significantly higher thanthose induced by alum. We demonstrated that recombinant PfHDP is a useful enzyme forproducing a natural vaccine adjuvant, esHz, which induces Th-1 cell immunity.Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/nano14171440/s1, Figure S1: Changes in ovalbumin (OVA)-specific IgG2c and IgG1 levels in mouse serum after the second subcutaneous dose; Figure S2: Aluminduces ovalbumin (OVA)-specific IgE but not enzymatically synthesized analog of Hz (esHz).Author Contributions: Conceptualization, L.B., K.S. and T.Y.; data curation, K.H., A.T.T.T., M.S.and T.Y.; formal analysis, K.H. and T.Y.; funding acquisition, T.Y.; investigation, K.H., W.T. and T.Y.;methodology, K.H., A.T.T.T., M.S., K.K., Y.H. and T.Y.; project administration, T.Y.; resources, L.B.,T.F., R.A. and T.Y.; supervision, L.B., K.I., K.S. and T.Y.; validation, K.H. and T.Y.; visualization, K.H.and T.Y.; writing—original draft, K.H. and T.Y.; writing—review and editing, K.H., L.Y., L.B. and T.Y.All authors have read and agreed to the published version of the manuscript.Funding: This research was funded by the Japan Society for the Promotion of Science Kakenhigrant numbers (17KK0122, 15K06589) and the Japan Agency for Medical Research and Development(AMED) for the translational and clinical research core institutes under the Tsukuba Clinical Research& Development Organization (A18-58).Data Availability Statement: The data that support the findings of this study are available from thecorresponding author, T.Y., upon reasonable request.Acknowledgments: This work was conducted at the NIMS Molecule and Material Synthesis platform,supported by the Nanotechnology Platform Program of the Ministry of Education, Culture, Sports,Science, and Technology (MEXT), Japan.Conflicts of Interest: The authors declare no conflicts of interest.References1. Higdon, A.N.; Benavides, G.A.; Chacko, B.K.; Ouyang, X.; Johnson, M.S.; Landar, A.; Zhang, J.; Darley-Usmar, V.M. Hemin causesmitochondrial dysfunction in endothelial cells through promoting lipid peroxidation: The protective role of autophagy. Am. J.Physiol. Heart Circ. Physiol. 2012, 302, H1394–H1409. [CrossRef] [PubMed]2. Jani, D.; Nagarkatti, R.; Beatty, W.; Angel, R.; Slebodnick, C.; Andersen, J.; Kumar, S.; Rathore, D. HDP—A novel hemedetoxification protein from the malaria parasite. PLoS Pathog. 2008, 4, e1000053. [CrossRef]3. Soni, A.; Goyal, M.; Prakash, K.; Bhardwaj, J.; Siddiqui, A.J.; Puri, S.K. Cloning, expression and functional characterization ofheme detoxification protein (HDP) from the rodent malaria parasite Plasmodium vinckei. Gene 2015, 566, 109–119. [CrossRef][PubMed]4. Nakatani, K.; Ishikawa, H.; Aono, S.; Mizutani, Y. Identification of essential histidine residues involved in heme binding andHemozoin formation in heme detoxification protein from Plasmodium falciparum. Sci. Rep. 2014, 4, 6137. [CrossRef]5. Nakatani, K.; Ishikawa, H.; Aono, S.; Mizutani, Y. Heme-binding properties of heme detoxification protein from Plasmodiumfalciparum. Biochem. Biophys. Res. Commun. 2013, 439, 477–480. [CrossRef] [PubMed]6. Coban, C.; Igari, Y.; Yagi, M.; Reimer, T.; Koyama, S.; Aoshi, T.; Ohata, K.; Tsukui, T.; Takeshita, F.; Sakurai, K.; et al. Immunogenic-ity of whole-parasite vaccines against Plasmodium falciparum involves malarial hemozoin and host TLR9. Cell Host Microbe 2010, 7,50–61. [CrossRef]7. Coban, C.; Yagi, M.; Ohata, K.; Igari, Y.; Tsukui, T.; Horii, T.; Ishii, K.J.; Akira, S. The malarial metabolite hemozoin and itspotential use as a vaccine adjuvant. Allergol. Int. 2010, 59, 115–124. [CrossRef]8. Griffith, J.W.; Sun, T.; McIntosh, M.T.; Bucala, R. Pure Hemozoin is inflammatory in vivo and activates the NALP3 inflammasomevia release of uric acid. J. Immunol. 2009, 183, 5208–5220. [CrossRef]9. Hoang, A.N.; Sandlin, R.D.; Omar, A.; Egan, T.J.; Wright, D.W. The neutral lipid composition present in the digestive vacuole ofPlasmodium falciparum concentrates heme and mediates β-hematin formation with an unusually low activation energy. Biochemistry2010, 49, 10107–10116. [CrossRef]10. Jaramillo, M.; Godbout, M.; Olivier, M. Hemozoin induces macrophage chemokine expression through oxidative stress-dependentand -independent mechanisms. J. Immunol. 2005, 174, 475–484. [CrossRef]https://www.mdpi.com/article/10.3390/nano14171440/s1https://www.mdpi.com/article/10.3390/nano14171440/s1https://doi.org/10.1152/ajpheart.00584.2011https://www.ncbi.nlm.nih.gov/pubmed/22245770https://doi.org/10.1371/journal.ppat.1000053https://doi.org/10.1016/j.gene.2015.04.037https://www.ncbi.nlm.nih.gov/pubmed/25891072https://doi.org/10.1038/srep06137https://doi.org/10.1016/j.bbrc.2013.08.100https://www.ncbi.nlm.nih.gov/pubmed/24025682https://doi.org/10.1016/j.chom.2009.12.003https://doi.org/10.2332/allergolint.10-RAI-0194https://doi.org/10.4049/jimmunol.0713552https://doi.org/10.1021/bi101397uhttps://doi.org/10.4049/jimmunol.174.1.475Nanomaterials 2024, 14, 1440 13 of 1311. Jaramillo, M.; Gowda, D.C.; Radzioch, D.; Olivier, M. Hemozoin increases IFN-γ-inducible macrophage nitric oxide generationthrough extracellular signal-regulated kinase- and NF-κ B-dependent pathways. J. Immunol. 2003, 171, 4243–4253. [CrossRef][PubMed]12. Jaramillo, M.; Plante, I.; Ouellet, N.; Vandal, K.; Tessier, P.A.; Olivier, M. Hemozoin-inducible proinflammatory events in vivo:Potential role in malaria infection. J. Immunol. 2004, 172, 3101–3110. [CrossRef] [PubMed]13. Coban, C.; Ishii, K.J.; Horii, T.; Akira, S. Manipulation of host innate immune responses by the malaria parasite. Trends Microbiol.2007, 15, 271–278. [CrossRef]14. Coban, C.; Ishii, K.J.; Sullivan, D.J.; Kumar, N. Purified malaria pigment (hemozoin) enhances dendritic cell maturation andmodulates the isotype of antibodies induced by a DNA vaccine. Infect. Immun. 2002, 70, 3939–3943. [CrossRef]15. Coban, C.; Ishii, K.J.; Kawai, T.; Hemmi, H.; Sato, S.; Uematsu, S.; Yamamoto, M.; Takeuchi, O.; Itagaki, S.; Kumar, N.; et al.Toll-like receptor 9 mediates innate immune activation by the malaria pigment hemozoin. J. Exp. Med. 2005, 201, 19–25. [CrossRef][PubMed]16. Deroost, K.; Lays, N.; Pham, T.T.; Baci, D.; Van den Eynde, K.; Komuta, M.; Prato, M.; Roskams, T.; Schwarzer, E.; Opdenakker, G.;et al. Hemozoin Induces Hepatic Inflammation in Mice and Is Differentially Associated with Liver Pathology Depending on thePlasmodium Strain. PLoS ONE 2014, 9, e113519. [CrossRef]17. Deroost, K.; Tyberghein, A.; Lays, N.; Noppen, S.; Schwarzer, E.; Vanstreels, E.; Komuta, M.; Prato, M.; Lin, J.W.; Pamplona, A.;et al. Hemozoin Induces Lung Inflammation and Correlates with Malaria-Associated Acute Respiratory Distress Syndrome. Am.J. Respir. Cell Mol. 2013, 48, 589–600. [CrossRef]18. Raulf, M.K.; Johannssen, T.; Matthiesen, S.; Neumann, K.; Hachenberg, S.; Mayer-Lambertz, S.; Steinbeis, F.; Hegermann, J.;Seeberger, P.H.; Baumgartner, W.; et al. The C-type Lectin Receptor CLEC12A Recognizes Plasmodial Hemozoin and Contributesto Cerebral Malaria Development. Cell Rep. 2019, 28, 30–38.e5. [CrossRef]19. Bohle, D.S.; Helms, J.B. Synthesis of β-hematin by dehydrohalogenation of hemin. Biochem. Biophys. Res. Commun. 1993, 193,504–508. [CrossRef]20. Zhao, D.; Tu, A.T.T.; Shobo, M.; Le, N.B.T.; Yoshikawa, C.; Sugai, K.; Hakamata, Y.; Yamazaki, T. Non-Modified CpG Oligodeoxynu-cleotide Forming Guanine-Quadruplex Structure Complexes with ε-Poly-(L)-Lysine Induce Antibody Production as VaccineAdjuvants. Biomolecules 2022, 12, 1868. [CrossRef]21. Takahashi, Y.; Maezawa, T.; Araie, Y.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. In Vitro and In Vivo Stimulation of Toll-LikeReceptor 9 by CpG Oligodeoxynucleotides Incorporated Into Polypod-Like DNA Nanostructures. J. Pharm. Sci. 2017, 106,2457–2462. [CrossRef]22. Hyeon, J.E.; Jeong, D.W.; Ko, Y.J.; Kim, S.W.; Park, C.; Han, S.O. Biomimetic magnetoelectric nanocrystals synthesized bypolymerization of heme as advanced nanomaterials for biosensing application. Biosens. Bioelectron. 2018, 114, 1–9. [CrossRef][PubMed]23. Noland, G.S.; Briones, N.; Sullivan, D.J., Jr. The shape and size of hemozoin crystals distinguishes diverse Plasmodium species.Mol. Biochem. Parasitol. 2003, 130, 91–99. [CrossRef] [PubMed]24. Belcher, J.D.; Chen, C.S.; Nguyen, J.; Milbauer, L.M.; Abdulla, F.; Alayash, A.I.; Smith, A.; Nath, K.A.; Hebbel, R.P.; Vercellotti,G.M. Heme triggers TLR4 signaling leading to endothelial cell activation and vaso-occlusion in murine sickle cell disease. Blood2014, 123, 377–390. [CrossRef]25. Lee, M.S.; Igari, Y.; Tsukui, T.; Ishii, K.J.; Coban, C. Current status of synthetic hemozoin adjuvant: A preliminary safety evaluation.Vaccine 2016, 34, 2055–2061. [CrossRef]Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individualauthor(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury topeople or property resulting from any ideas, methods, instructions or products referred to in the content.https://doi.org/10.4049/jimmunol.171.8.4243https://www.ncbi.nlm.nih.gov/pubmed/14530348https://doi.org/10.4049/jimmunol.172.5.3101https://www.ncbi.nlm.nih.gov/pubmed/14978116https://doi.org/10.1016/j.tim.2007.04.003https://doi.org/10.1128/IAI.70.7.3939-3943.2002https://doi.org/10.1084/jem.20041836https://www.ncbi.nlm.nih.gov/pubmed/15630134https://doi.org/10.1371/journal.pone.0113519https://doi.org/10.1165/rcmb.2012-0450OChttps://doi.org/10.1016/j.celrep.2019.06.015https://doi.org/10.1006/bbrc.1993.1652https://doi.org/10.3390/biom12121868https://doi.org/10.1016/j.xphs.2017.03.028https://doi.org/10.1016/j.bios.2018.05.007https://www.ncbi.nlm.nih.gov/pubmed/29775852https://doi.org/10.1016/S0166-6851(03)00163-4https://www.ncbi.nlm.nih.gov/pubmed/12946845https://doi.org/10.1182/blood-2013-04-495887https://doi.org/10.1016/j.vaccine.2016.02.0641  Supporting Information  Potential of Enzymatically Synthesized Hemozoin Analog as Th1 Cell Adjuvant Kazuaki Hoshi 1, Anh Thi Tram Tu 1,2,3, Miwako Shobo 1, Karin Kettisen 4, Lei Ye 4, Leif Bülow 4,*, Yoji Hakamata 5, Tetsuya Furuya 6, Ryutaro Asano 7, Wakako Tsugawa 7, Kazunori Ikebukuro 7, Koji Sode 8 and  Tomohiko Yamazaki 1,9,* 1 Research Center for Macromolecules and Biomaterials, National Institute for Materials Science (NIMS), Tsukuba 305-0047, Japan; k.hoshi.oe@juntendo.ac.jp (K.H.); tttanh@hcmus.edu.vn (A.T.T.T.);  shobo.miwako@nims.go.jp (M.S.) 2 Department of Magnetic and Biomedical Materials, Faculty of Materials Science and Technology, University of Science, Ho Chi Minh City 70000, Vietnam 3 Ho Chi Minh City Campus, Vietnam National University, Thu Duc City, Ho Chi Minh City 70000, Vietnam 4 Division of Pure and Applied Biochemistry, Department of Chemistry, Lund University,  22100 Lund, Sweden; karinkettisen@gmail.com (K.K.); lei.ye@tbiokem.lth.se (L.Y.) 5 School of Veterinary Nursing and Technology, Nippon Veterinary and Life Science University,  Musashino 180-8602, Tokyo, Japan; yhakama@nvlu.ac.jp 6 Cooperative Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture and Technology, Fuchu 183-8509, Tokyo, Japan; furuyat@cc.tuat.ac.jp 7 Department of Biotechnology and Life science, Graduate School of Engineering, Tokyo University of  Agriculture and Technology, Koganei 184-8588, Tokyo, Japan; ryutaroa@cc.tuat.ac.jp (R.A.);  tsugawa@cc.tuat.ac.jp (W.T.); ikebu@cc.tuat.ac.jp (K.I.) 8 Joint Department of Biomedical Engineering, The University of North Carolina at Chapel Hill and North Carolina State University, Chapel Hill, NC 27599, USA; ksode@email.unc.edu 9 Graduate School of Life Science, Hokkaido University, Sapporo 060-0808, Japan * Correspondence: yamazaki.tomohiko@nims.go.jp (T.Y.); leif.bulow@kilu.lu.se (L.B.)  Supplementary Figures 1-2 2   Figure S1. Changes in ovalbumin (OVA)-specific IgG2c and IgG1 levels in mouse serum after the second subcutaneous dose. Serum OVA-specific IgG2c and IgG1 levels were measured using enzyme-linked immunosorbent assays. Mice were immunized with OVA (200 µg) and an enzymatically synthesized analog of hemozoin (esHz) (500 µg), OVA (200 µg), alum (500 µg), and OVA alone at one-week intervals, and the mice were boosted with OVA (200 µg) at six weeks after the second dose. Results are expressed as mean ± standard error of the mean (n = 10 to 12). #The levels of OVA-specific IgG2c were lower than the detectable minimum of 0.39 ng/mL.  3   Figure S2. Alum induces ovalbumin (OVA)-specific IgE but not the enzymatically synthesized analog of hemozoin (esHz). OVA-specific IgE levels were induced by either the esHz or alum adjuvant at two and six weeks after the second dose of the vaccine. Serum collected from the immunized mice (Figure 5) was used for OVA-specific IgE measurement using enzyme-linked immunosorbent assay. Results are expressed as the mean ± standard deviation (n = 8). * OVA-IgE levels were lower than the detectable minimum of 15 ng/mL.  Introduction  Materials and Methods  Reagents  Expression and Purification of HDP  esHz Formation Assay  csHz Preparation  Generation of Infra-Red (IR) Spectra and Scanning Electron Microscope (SEM) Images  Mammalian Cell Culture and Immunostimulation  RT-qPCR and ELISA  Administration of OVA with esHz in Mice and Measurement of OVA-Specific IgG Level  Statistical Analysis  Results  Cold-Shock with Co-Expression of Chaperones Improves the Solubility of PfHDP  esHz Induces Immunostimulatory Cytokine Production in RAW264 Cells and PBMCs  esHz Induces the Cytokines and OVA-Specific IgG Induction in Mice  Discussion  Conclusions  References